Incidental Mutation 'R7775:Plau'
ID598848
Institutional Source Beutler Lab
Gene Symbol Plau
Ensembl Gene ENSMUSG00000021822
Gene Nameplasminogen activator, urokinase
Synonymsurokinase-type plasminogen activator, uPA, u-PA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7775 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20836660-20843385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20842325 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 393 (S393G)
Ref Sequence ENSEMBL: ENSMUSP00000022368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022368] [ENSMUST00000224141]
PDB Structure
Structure-based engineering of species selectivity in the uPA-uPAR interaction [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022368
AA Change: S393G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022368
Gene: ENSMUSG00000021822
AA Change: S393G

DomainStartEndE-ValueType
EGF 10 64 3.23e0 SMART
KR 69 154 3.2e-36 SMART
Tryp_SPc 179 421 3.53e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224141
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted serine protease that converts plasminogen to plasmin. The encoded preproprotein is proteolytically processed to generate A and B polypeptide chains. These chains associate via a single disulfide bond to form the catalytically inactive high molecular weight urokinase-type plasminogen activator (HMW-uPA). HMW-uPA can be further processed into the catalytically active low molecular weight urokinase-type plasminogen activator (LMW-uPA). This low molecular weight form does not bind to the urokinase-type plasminogen activator receptor. Mutations in this gene may be associated with Quebec platelet disorder and late-onset Alzheimer's disease. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes show occasional fibrin deposits in non-healing ulcerations and reduced neointima formation after arterial injury. They are susceptible to thrombosis after traumatic or inflammatory challenge and appear to be immunologically hyporesponsive displaying characteristics of functional anergy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Plau
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Plau APN 14 20838567 missense probably benign 0.05
IGL01831:Plau APN 14 20837770 splice site probably benign
IGL02902:Plau APN 14 20839897 missense possibly damaging 0.63
R0426:Plau UTSW 14 20842314 missense probably benign 0.23
R2006:Plau UTSW 14 20838692 splice site probably null
R2357:Plau UTSW 14 20838615 missense probably damaging 1.00
R4089:Plau UTSW 14 20841066 missense probably damaging 1.00
R4866:Plau UTSW 14 20837804 missense probably benign 0.05
R6737:Plau UTSW 14 20837816 missense probably damaging 0.98
R7167:Plau UTSW 14 20839450 missense possibly damaging 0.90
R7615:Plau UTSW 14 20839466 nonsense probably null
R7687:Plau UTSW 14 20839798 missense probably damaging 1.00
R7824:Plau UTSW 14 20842325 missense probably benign 0.16
Z1176:Plau UTSW 14 20839481 missense probably damaging 1.00
Z1177:Plau UTSW 14 20841014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGGGAGTTGCGAATGTC -3'
(R):5'- ATGCAAAACCTGTCTTTTCAGC -3'

Sequencing Primer
(F):5'- AATGTCTCTGACTCTGGGAGCC -3'
(R):5'- CATTTGACGACTCTGTTGCAG -3'
Posted On2019-11-26