Incidental Mutation 'R7775:Prph2'
ID598860
Institutional Source Beutler Lab
Gene Symbol Prph2
Ensembl Gene ENSMUSG00000023978
Gene Nameperipherin 2
SynonymsNmf193, Rd2, rds, Tspan22
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7775 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46910459-46924933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46910806 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 37 (L37S)
Ref Sequence ENSEMBL: ENSMUSP00000024773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024773
AA Change: L37S

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: L37S

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 288 2.2e-28 PFAM
low complexity region 333 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Ttll3 AAAGT AAAGTTAAGT 6: 113,399,158 probably null Het
Ttll3 AGTAAG AGTAAGGTAAG 6: 113,399,160 probably null Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Prph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Prph2 APN 17 46919778 missense probably damaging 0.97
IGL01087:Prph2 APN 17 46911159 missense probably damaging 0.97
PIT4480001:Prph2 UTSW 17 46911113 frame shift probably null
R0025:Prph2 UTSW 17 46919771 missense probably benign 0.17
R2235:Prph2 UTSW 17 46911166 missense probably damaging 1.00
R3120:Prph2 UTSW 17 46923372 missense possibly damaging 0.49
R3954:Prph2 UTSW 17 46910718 missense probably benign 0.39
R4864:Prph2 UTSW 17 46910922 missense probably benign 0.03
R4972:Prph2 UTSW 17 46910807 missense possibly damaging 0.94
R5645:Prph2 UTSW 17 46910667 start gained probably benign
R5687:Prph2 UTSW 17 46923465 missense probably damaging 0.99
R6494:Prph2 UTSW 17 46911081 missense probably benign 0.03
R6658:Prph2 UTSW 17 46919864 missense probably benign 0.05
R7778:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7824:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTAACGGGGATCCCAAGCTAG -3'
(R):5'- TTCCACTTGGCGTACTTGGC -3'

Sequencing Primer
(F):5'- AACTCCCTGCAGCTTGGG -3'
(R):5'- TACTTGGCCGGGTCCAG -3'
Posted On2019-11-26