Incidental Mutation 'R7775:Txndc2'
ID 598862
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Name thioredoxin domain containing 2 (spermatozoa)
Synonyms Sptrx-1
MMRRC Submission 045831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.211) question?
Stock # R7775 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 65944502-65949163 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65945238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050236
AA Change: V313A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612
AA Change: V313A

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,296,573 (GRCm39) K831E probably benign Het
Arpc1a C T 5: 145,041,622 (GRCm39) R302C probably benign Het
Asb5 A C 8: 55,037,827 (GRCm39) H173P Het
Atp6v0a2 A G 5: 124,779,443 (GRCm39) E186G probably damaging Het
Bbs2 A T 8: 94,816,388 (GRCm39) probably null Het
Capn7 A G 14: 31,074,367 (GRCm39) T257A probably benign Het
Car4 T C 11: 84,856,449 (GRCm39) S246P probably damaging Het
Chrm5 A G 2: 112,310,301 (GRCm39) S272P probably benign Het
Chrna6 T C 8: 27,897,392 (GRCm39) I162V probably damaging Het
Chst12 T A 5: 140,509,376 (GRCm39) M1K probably null Het
Cldn6 T A 17: 23,900,581 (GRCm39) C182S probably damaging Het
Coro6 T G 11: 77,356,599 (GRCm39) D102E probably benign Het
Cysltr2 A G 14: 73,267,203 (GRCm39) I169T probably benign Het
Dtx4 G T 19: 12,469,374 (GRCm39) P251Q probably benign Het
Dyrk3 C T 1: 131,057,364 (GRCm39) V270I possibly damaging Het
Efhc1 A T 1: 21,049,685 (GRCm39) Y515F probably damaging Het
Ep300 T C 15: 81,470,887 (GRCm39) S20P unknown Het
Fmnl2 C T 2: 52,963,692 (GRCm39) L275F unknown Het
Fstl4 C T 11: 53,067,798 (GRCm39) Q554* probably null Het
Gal3st2b G T 1: 93,868,506 (GRCm39) D246Y probably damaging Het
Gkap1 A T 13: 58,398,966 (GRCm39) D188E probably benign Het
Gm14226 T A 2: 154,866,630 (GRCm39) C196S possibly damaging Het
Gm8297 A G 14: 16,167,939 (GRCm39) N193S possibly damaging Het
Grm8 T C 6: 27,363,671 (GRCm39) R615G possibly damaging Het
Ing1 A G 8: 11,611,814 (GRCm39) E178G probably benign Het
Kansl3 A T 1: 36,387,758 (GRCm39) L530H probably damaging Het
Kcna5 A T 6: 126,511,768 (GRCm39) L120* probably null Het
Kif26b T A 1: 178,692,441 (GRCm39) S461T probably benign Het
L3mbtl3 A T 10: 26,228,215 (GRCm39) V15E unknown Het
Lama4 A T 10: 38,954,843 (GRCm39) H1132L probably damaging Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Ldlrad4 T C 18: 68,368,827 (GRCm39) S95P probably damaging Het
Liph G T 16: 21,777,664 (GRCm39) L379I probably damaging Het
Lrp2 T A 2: 69,331,883 (GRCm39) E1624V possibly damaging Het
Matn2 A T 15: 34,399,223 (GRCm39) H370L possibly damaging Het
Mettl23 T G 11: 116,740,096 (GRCm39) V189G probably benign Het
Mpp4 G A 1: 59,162,672 (GRCm39) T543M not run Het
Mrps15 A T 4: 125,945,170 (GRCm39) N119I probably damaging Het
Or10d4 C A 9: 39,580,534 (GRCm39) F60L possibly damaging Het
Or5ac21 A T 16: 59,123,614 (GRCm39) I33F probably damaging Het
Or7d9 A G 9: 20,193,708 (GRCm39) probably benign Het
Or8b36 T A 9: 37,937,963 (GRCm39) I287N probably damaging Het
Or8g21 T A 9: 38,906,203 (GRCm39) H176L probably damaging Het
Pax8 A G 2: 24,325,913 (GRCm39) S324P possibly damaging Het
Pcdha11 A T 18: 37,145,733 (GRCm39) Y608F possibly damaging Het
Pcdhga5 A G 18: 37,828,578 (GRCm39) D342G probably damaging Het
Pde6d A G 1: 86,471,250 (GRCm39) S143P probably damaging Het
Plau A G 14: 20,892,393 (GRCm39) S393G probably benign Het
Plec A T 15: 76,061,135 (GRCm39) I2934N probably damaging Het
Primpol G T 8: 47,039,459 (GRCm39) P387Q probably damaging Het
Prph2 T C 17: 47,221,732 (GRCm39) L37S possibly damaging Het
Prrt4 A G 6: 29,177,718 (GRCm39) L17P probably damaging Het
Pycr3 T C 15: 75,790,138 (GRCm39) D171G probably damaging Het
Rapgefl1 A G 11: 98,741,980 (GRCm39) N648S probably damaging Het
Rapsn A G 2: 90,875,293 (GRCm39) T359A probably benign Het
Sap25 C T 5: 137,640,186 (GRCm39) R66W probably benign Het
Setd6 A T 8: 96,442,866 (GRCm39) H101L probably benign Het
Slc22a3 G T 17: 12,683,350 (GRCm39) A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 (GRCm39) probably null Het
Tfap2b G A 1: 19,304,531 (GRCm39) G447D probably damaging Het
Uevld A T 7: 46,576,100 (GRCm39) I462N probably damaging Het
Vmn2r120 T C 17: 57,832,942 (GRCm39) Y79C probably damaging Het
Vwa8 T C 14: 79,275,587 (GRCm39) V790A probably benign Het
Zfp936 A G 7: 42,839,720 (GRCm39) T396A possibly damaging Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65,945,569 (GRCm39) missense probably benign 0.41
IGL00985:Txndc2 APN 17 65,945,544 (GRCm39) missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65,945,448 (GRCm39) missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65,945,908 (GRCm39) missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65,944,971 (GRCm39) missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65,946,585 (GRCm39) missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65,946,601 (GRCm39) missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65,944,948 (GRCm39) missense probably benign 0.01
R0737:Txndc2 UTSW 17 65,946,548 (GRCm39) critical splice donor site probably null
R1525:Txndc2 UTSW 17 65,945,310 (GRCm39) missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65,945,921 (GRCm39) missense probably benign 0.44
R1746:Txndc2 UTSW 17 65,945,130 (GRCm39) missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65,945,079 (GRCm39) missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65,945,849 (GRCm39) missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65,945,055 (GRCm39) missense probably benign 0.01
R6177:Txndc2 UTSW 17 65,945,466 (GRCm39) missense probably benign 0.44
R6762:Txndc2 UTSW 17 65,945,967 (GRCm39) missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65,945,286 (GRCm39) missense probably benign
R7574:Txndc2 UTSW 17 65,945,620 (GRCm39) missense possibly damaging 0.86
R9294:Txndc2 UTSW 17 65,946,019 (GRCm39) missense unknown
R9359:Txndc2 UTSW 17 65,944,992 (GRCm39) missense probably damaging 0.99
R9403:Txndc2 UTSW 17 65,944,992 (GRCm39) missense probably damaging 0.99
R9669:Txndc2 UTSW 17 65,945,583 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCCTTGGACTGGATGGATTC -3'
(R):5'- CAGGCCCAAGTCCTCAGAAG -3'

Sequencing Primer
(F):5'- CATGGGAGGACTTAGGTTCTTCACTC -3'
(R):5'- GACAGGCCCAAGTCCTCAG -3'
Posted On 2019-11-26