Incidental Mutation 'R7775:Pcdhga5'
ID598864
Institutional Source Beutler Lab
Gene Symbol Pcdhga5
Ensembl Gene ENSMUSG00000103567
Gene Nameprotocadherin gamma subfamily A, 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R7775 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37694380-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37695525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000141893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193414
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567
AA Change: D342G

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Pcdhga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4581001:Pcdhga5 UTSW 18 37696857 missense probably benign 0.01
R3775:Pcdhga5 UTSW 18 37695114 missense possibly damaging 0.89
R4232:Pcdhga5 UTSW 18 37695948 missense possibly damaging 0.54
R4234:Pcdhga5 UTSW 18 37695948 missense possibly damaging 0.54
R4235:Pcdhga5 UTSW 18 37695948 missense possibly damaging 0.54
R4815:Pcdhga5 UTSW 18 37695194 missense probably damaging 0.99
R4884:Pcdhga5 UTSW 18 37694627 missense probably damaging 0.99
R5159:Pcdhga5 UTSW 18 37695666 missense probably benign 0.24
R5279:Pcdhga5 UTSW 18 37694721 missense probably benign 0.12
R5393:Pcdhga5 UTSW 18 37696667 missense probably benign 0.25
R6271:Pcdhga5 UTSW 18 37696682 missense probably benign 0.01
R6574:Pcdhga5 UTSW 18 37695381 missense probably damaging 1.00
R7727:Pcdhga5 UTSW 18 37695045 missense probably benign 0.41
R7747:Pcdhga5 UTSW 18 37696782 missense possibly damaging 0.69
R7778:Pcdhga5 UTSW 18 37695525 missense probably damaging 1.00
R7819:Pcdhga5 UTSW 18 37696580 missense probably damaging 1.00
Z1177:Pcdhga5 UTSW 18 37695534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTTCCGCAACGAAGAAGAC -3'
(R):5'- TCAACAACGGTCACTGTGATG -3'

Sequencing Primer
(F):5'- CGCAACGAAGAAGACAAAATTTCTG -3'
(R):5'- ACGGTCACTGTGATGTTATAATCTG -3'
Posted On2019-11-26