Incidental Mutation 'R7776:Rnf20'
ID 598878
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 49644592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 286 (Q286*)
Ref Sequence ENSEMBL: ENSMUSP00000029989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect probably null
Transcript: ENSMUST00000029989
AA Change: Q286*
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: Q286*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146547
SMART Domains Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156314
AA Change: Q286*
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: Q286*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167496
AA Change: Q286*
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: Q286*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,232,991 probably null Het
Abca3 T A 17: 24,386,276 V716D possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Alkbh1 A G 12: 87,431,445 V232A probably damaging Het
Arhgef10l T A 4: 140,575,331 I271F probably damaging Het
Aspm T A 1: 139,479,846 M2157K possibly damaging Het
Capn13 G A 17: 73,322,054 S586L probably benign Het
Cd3g A T 9: 44,974,161 probably null Het
Cfap54 A T 10: 92,868,741 Y2826N unknown Het
Cmas T C 6: 142,764,557 V134A probably damaging Het
Cnp A G 11: 100,578,988 H250R probably damaging Het
Dact1 G A 12: 71,317,914 A453T probably benign Het
Dcaf6 T A 1: 165,352,054 R506* probably null Het
Dph1 A G 11: 75,190,446 V5A probably benign Het
Entpd3 A G 9: 120,558,502 Y255C probably damaging Het
Etl4 A T 2: 20,807,146 T1715S probably damaging Het
Exd2 T A 12: 80,492,560 H466Q probably damaging Het
Fbln2 A G 6: 91,269,199 N1056S probably damaging Het
Fcrl5 A T 3: 87,444,195 Q250L possibly damaging Het
Fignl2 A G 15: 101,053,420 V327A unknown Het
Gm10226 T A 17: 21,691,959 C34S possibly damaging Het
Gm15448 T C 7: 3,823,247 N249S unknown Het
Hist1h2be A T 13: 23,585,955 M1K probably null Het
Kdm6b A G 11: 69,406,134 S436P possibly damaging Het
Lmnb2 G T 10: 80,918,157 A21E possibly damaging Het
Mcf2l A T 8: 12,880,127 E49V probably benign Het
Muc2 A G 7: 141,704,393 E76G Het
Naa60 T C 16: 3,900,709 I135T probably benign Het
Neb T C 2: 52,207,701 Y4924C possibly damaging Het
Nlrp10 T A 7: 108,925,449 I275F probably damaging Het
Nr3c2 T C 8: 76,909,545 V425A possibly damaging Het
Nucb2 T A 7: 116,529,013 D286E probably damaging Het
Nynrin G A 14: 55,865,963 G755S probably damaging Het
Olfr1170 T C 2: 88,224,085 T316A probably damaging Het
Padi2 T A 4: 140,924,345 D135E probably benign Het
Pcdha6 T A 18: 36,969,981 S742R probably benign Het
Pcdhgb5 T A 18: 37,732,954 S601T probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prr15l T C 11: 96,934,564 W7R possibly damaging Het
Ptpn23 G A 9: 110,386,300 H1431Y possibly damaging Het
Rptor T C 11: 119,892,627 I1149T probably benign Het
Sfrp2 A G 3: 83,766,779 I80V probably benign Het
Slc38a2 T C 15: 96,690,152 D497G probably benign Het
Slc43a1 T A 2: 84,840,853 M44K probably damaging Het
Stil T A 4: 115,032,838 V841E possibly damaging Het
Stip1 T A 19: 7,021,773 H479L probably benign Het
Supt6 A G 11: 78,209,529 Y1486H probably damaging Het
Taf6 T C 5: 138,182,020 D324G probably damaging Het
Tgif1 T A 17: 70,851,457 probably benign Het
Tmprss11f T C 5: 86,533,746 E216G probably benign Het
Tmprss7 C A 16: 45,667,651 A472S probably benign Het
Trpm1 T A 7: 64,248,191 F1191I probably benign Het
Tspan12 T A 6: 21,836,443 N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,399,159 probably null Het
Unc13c A T 9: 73,694,950 I1338N probably damaging Het
Vegfc T A 8: 54,077,800 S8T unknown Het
Vmn1r59 T A 7: 5,454,635 Q42L probably damaging Het
Vmn2r-ps117 A T 17: 18,823,672 I337F probably damaging Het
Xylb G A 9: 119,380,700 probably null Het
Zfp551 T A 7: 12,418,642 I55F probably damaging Het
Zfp972 T C 2: 177,921,739 N27S probably benign Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAATTTGGAATGCTTGACTCAGTC -3'
(R):5'- AAACACTTGCTGCTCTTGC -3'

Sequencing Primer
(F):5'- GAATGCTTGACTCAGTCCTTTTG -3'
(R):5'- CTGTAGCTCCAGGGGATCTAATAC -3'
Posted On 2019-11-26