Incidental Mutation 'R7776:Padi2'
ID598881
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7776 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140924345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 135 (D135E)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably benign
Transcript: ENSMUST00000030765
AA Change: D135E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: D135E

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,232,991 probably null Het
Abca3 T A 17: 24,386,276 V716D possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Alkbh1 A G 12: 87,431,445 V232A probably damaging Het
Arhgef10l T A 4: 140,575,331 I271F probably damaging Het
Aspm T A 1: 139,479,846 M2157K possibly damaging Het
Capn13 G A 17: 73,322,054 S586L probably benign Het
Cd3g A T 9: 44,974,161 probably null Het
Cfap54 A T 10: 92,868,741 Y2826N unknown Het
Cmas T C 6: 142,764,557 V134A probably damaging Het
Cnp A G 11: 100,578,988 H250R probably damaging Het
Dact1 G A 12: 71,317,914 A453T probably benign Het
Dcaf6 T A 1: 165,352,054 R506* probably null Het
Dph1 A G 11: 75,190,446 V5A probably benign Het
Entpd3 A G 9: 120,558,502 Y255C probably damaging Het
Etl4 A T 2: 20,807,146 T1715S probably damaging Het
Exd2 T A 12: 80,492,560 H466Q probably damaging Het
Fbln2 A G 6: 91,269,199 N1056S probably damaging Het
Fcrl5 A T 3: 87,444,195 Q250L possibly damaging Het
Fignl2 A G 15: 101,053,420 V327A unknown Het
Gm10226 T A 17: 21,691,959 C34S possibly damaging Het
Gm15448 T C 7: 3,823,247 N249S unknown Het
Hist1h2be A T 13: 23,585,955 M1K probably null Het
Kdm6b A G 11: 69,406,134 S436P possibly damaging Het
Lmnb2 G T 10: 80,918,157 A21E possibly damaging Het
Mcf2l A T 8: 12,880,127 E49V probably benign Het
Muc2 A G 7: 141,704,393 E76G Het
Naa60 T C 16: 3,900,709 I135T probably benign Het
Neb T C 2: 52,207,701 Y4924C possibly damaging Het
Nlrp10 T A 7: 108,925,449 I275F probably damaging Het
Nr3c2 T C 8: 76,909,545 V425A possibly damaging Het
Nucb2 T A 7: 116,529,013 D286E probably damaging Het
Nynrin G A 14: 55,865,963 G755S probably damaging Het
Olfr1170 T C 2: 88,224,085 T316A probably damaging Het
Pcdha6 T A 18: 36,969,981 S742R probably benign Het
Pcdhgb5 T A 18: 37,732,954 S601T probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prr15l T C 11: 96,934,564 W7R possibly damaging Het
Ptpn23 G A 9: 110,386,300 H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 Q286* probably null Het
Rptor T C 11: 119,892,627 I1149T probably benign Het
Sfrp2 A G 3: 83,766,779 I80V probably benign Het
Slc38a2 T C 15: 96,690,152 D497G probably benign Het
Slc43a1 T A 2: 84,840,853 M44K probably damaging Het
Stil T A 4: 115,032,838 V841E possibly damaging Het
Stip1 T A 19: 7,021,773 H479L probably benign Het
Supt6 A G 11: 78,209,529 Y1486H probably damaging Het
Taf6 T C 5: 138,182,020 D324G probably damaging Het
Tgif1 T A 17: 70,851,457 probably benign Het
Tmprss11f T C 5: 86,533,746 E216G probably benign Het
Tmprss7 C A 16: 45,667,651 A472S probably benign Het
Trpm1 T A 7: 64,248,191 F1191I probably benign Het
Tspan12 T A 6: 21,836,443 N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,399,159 probably null Het
Unc13c A T 9: 73,694,950 I1338N probably damaging Het
Vegfc T A 8: 54,077,800 S8T unknown Het
Vmn1r59 T A 7: 5,454,635 Q42L probably damaging Het
Vmn2r-ps117 A T 17: 18,823,672 I337F probably damaging Het
Xylb G A 9: 119,380,700 probably null Het
Zfp551 T A 7: 12,418,642 I55F probably damaging Het
Zfp972 T C 2: 177,921,739 N27S probably benign Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
R7574:Padi2 UTSW 4 140949337 missense possibly damaging 0.87
R7791:Padi2 UTSW 4 140917596 missense probably benign 0.00
R7810:Padi2 UTSW 4 140949264 missense possibly damaging 0.91
Z1177:Padi2 UTSW 4 140924335 missense possibly damaging 0.50
Z1177:Padi2 UTSW 4 140949727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGAAGATCAGCCTCCC -3'
(R):5'- ATGGACATCTCTGGCTGAATGC -3'

Sequencing Primer
(F):5'- CAAAGCTATTTGTGTCTGCTGAG -3'
(R):5'- CCCCATGCAGTCCCTGTG -3'
Posted On2019-11-26