Incidental Mutation 'R7776:Tspan12'
ID598884
Institutional Source Beutler Lab
Gene Symbol Tspan12
Ensembl Gene ENSMUSG00000029669
Gene Nametetraspanin 12
SynonymsTm4sf12
MMRRC Submission
Accession Numbers

Genbank: NM_173007; MGI: 1889818

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7776 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location21771395-21852515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21836443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 40 (N40I)
Ref Sequence ENSEMBL: ENSMUSP00000031678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031678] [ENSMUST00000120965] [ENSMUST00000123116] [ENSMUST00000134635] [ENSMUST00000143531]
Predicted Effect probably damaging
Transcript: ENSMUST00000031678
AA Change: N40I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031678
Gene: ENSMUSG00000029669
AA Change: N40I

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 248 1.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120965
AA Change: N40I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113384
Gene: ENSMUSG00000029669
AA Change: N40I

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 156 4.1e-23 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123116
AA Change: N40I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117820
Gene: ENSMUSG00000029669
AA Change: N40I

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 203 4.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134635
AA Change: N40I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123475
Gene: ENSMUSG00000029669
AA Change: N40I

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 129 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143531
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal vasculature with pericapillary occlusions, lack of vertical sprouts, gliosis, fenestration, microanurysms, hemorrhage, and delayed regression of hyaloid capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,232,991 probably null Het
Abca3 T A 17: 24,386,276 V716D possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Alkbh1 A G 12: 87,431,445 V232A probably damaging Het
Arhgef10l T A 4: 140,575,331 I271F probably damaging Het
Aspm T A 1: 139,479,846 M2157K possibly damaging Het
Capn13 G A 17: 73,322,054 S586L probably benign Het
Cd3g A T 9: 44,974,161 probably null Het
Cfap54 A T 10: 92,868,741 Y2826N unknown Het
Cmas T C 6: 142,764,557 V134A probably damaging Het
Cnp A G 11: 100,578,988 H250R probably damaging Het
Dact1 G A 12: 71,317,914 A453T probably benign Het
Dcaf6 T A 1: 165,352,054 R506* probably null Het
Dph1 A G 11: 75,190,446 V5A probably benign Het
Entpd3 A G 9: 120,558,502 Y255C probably damaging Het
Etl4 A T 2: 20,807,146 T1715S probably damaging Het
Exd2 T A 12: 80,492,560 H466Q probably damaging Het
Fbln2 A G 6: 91,269,199 N1056S probably damaging Het
Fcrl5 A T 3: 87,444,195 Q250L possibly damaging Het
Fignl2 A G 15: 101,053,420 V327A unknown Het
Gm10226 T A 17: 21,691,959 C34S possibly damaging Het
Gm15448 T C 7: 3,823,247 N249S unknown Het
Hist1h2be A T 13: 23,585,955 M1K probably null Het
Kdm6b A G 11: 69,406,134 S436P possibly damaging Het
Lmnb2 G T 10: 80,918,157 A21E possibly damaging Het
Mcf2l A T 8: 12,880,127 E49V probably benign Het
Muc2 A G 7: 141,704,393 E76G Het
Naa60 T C 16: 3,900,709 I135T probably benign Het
Neb T C 2: 52,207,701 Y4924C possibly damaging Het
Nlrp10 T A 7: 108,925,449 I275F probably damaging Het
Nr3c2 T C 8: 76,909,545 V425A possibly damaging Het
Nucb2 T A 7: 116,529,013 D286E probably damaging Het
Nynrin G A 14: 55,865,963 G755S probably damaging Het
Olfr1170 T C 2: 88,224,085 T316A probably damaging Het
Padi2 T A 4: 140,924,345 D135E probably benign Het
Pcdha6 T A 18: 36,969,981 S742R probably benign Het
Pcdhgb5 T A 18: 37,732,954 S601T probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prr15l T C 11: 96,934,564 W7R possibly damaging Het
Ptpn23 G A 9: 110,386,300 H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 Q286* probably null Het
Rptor T C 11: 119,892,627 I1149T probably benign Het
Sfrp2 A G 3: 83,766,779 I80V probably benign Het
Slc38a2 T C 15: 96,690,152 D497G probably benign Het
Slc43a1 T A 2: 84,840,853 M44K probably damaging Het
Stil T A 4: 115,032,838 V841E possibly damaging Het
Stip1 T A 19: 7,021,773 H479L probably benign Het
Supt6 A G 11: 78,209,529 Y1486H probably damaging Het
Taf6 T C 5: 138,182,020 D324G probably damaging Het
Tgif1 T A 17: 70,851,457 probably benign Het
Tmprss11f T C 5: 86,533,746 E216G probably benign Het
Tmprss7 C A 16: 45,667,651 A472S probably benign Het
Trpm1 T A 7: 64,248,191 F1191I probably benign Het
Ttll3 AAGTA AAGTACAGTA 6: 113,399,159 probably null Het
Unc13c A T 9: 73,694,950 I1338N probably damaging Het
Vegfc T A 8: 54,077,800 S8T unknown Het
Vmn1r59 T A 7: 5,454,635 Q42L probably damaging Het
Vmn2r-ps117 A T 17: 18,823,672 I337F probably damaging Het
Xylb G A 9: 119,380,700 probably null Het
Zfp551 T A 7: 12,418,642 I55F probably damaging Het
Zfp972 T C 2: 177,921,739 N27S probably benign Het
Other mutations in Tspan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Tspan12 APN 6 21851082 utr 5 prime probably benign
IGL02601:Tspan12 APN 6 21835379 unclassified probably benign
IGL02992:Tspan12 APN 6 21799877 critical splice donor site probably null
PIT4362001:Tspan12 UTSW 6 21835464 missense possibly damaging 0.87
R1800:Tspan12 UTSW 6 21795700 missense probably damaging 1.00
R1862:Tspan12 UTSW 6 21851023 missense probably damaging 1.00
R1898:Tspan12 UTSW 6 21795694 missense probably damaging 0.97
R2101:Tspan12 UTSW 6 21799888 missense probably benign 0.00
R2351:Tspan12 UTSW 6 21835507 missense probably benign
R4820:Tspan12 UTSW 6 21795661 missense probably damaging 0.99
R4921:Tspan12 UTSW 6 21835449 missense possibly damaging 0.66
R5284:Tspan12 UTSW 6 21835467 missense probably damaging 0.97
R5341:Tspan12 UTSW 6 21835459 missense possibly damaging 0.69
R5372:Tspan12 UTSW 6 21772699 missense probably benign 0.06
R5929:Tspan12 UTSW 6 21772747 missense possibly damaging 0.92
R6052:Tspan12 UTSW 6 21772638 missense probably benign 0.09
R6108:Tspan12 UTSW 6 21772771 missense probably benign
R6207:Tspan12 UTSW 6 21799908 missense probably damaging 1.00
R6248:Tspan12 UTSW 6 21799971 missense probably damaging 1.00
R7014:Tspan12 UTSW 6 21772919 missense probably benign 0.01
R7457:Tspan12 UTSW 6 21772683 missense probably benign 0.09
ZE80:Tspan12 UTSW 6 21795609 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACCGATGGAATTCCTTAAGGAG -3'
(R):5'- TGGAGTAGCCAGATATTTATGGTAC -3'

Sequencing Primer
(F):5'- CGATGGAATTCCTTAAGGAGAATGTG -3'
(R):5'- TGCTGCAGACATTTCTGG -3'
Posted On2019-11-26