Incidental Mutation 'R7776:Trpm1'
ID 598891
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 045832-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63897939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1191 (F1191I)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: F1191I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: F1191I

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: F1075I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206277
AA Change: F1197I

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206314
AA Change: F307I

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206848
AA Change: F91I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,832,214 (GRCm39) probably null Het
Abca3 T A 17: 24,605,250 (GRCm39) V716D possibly damaging Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Alkbh1 A G 12: 87,478,215 (GRCm39) V232A probably damaging Het
Arhgef10l T A 4: 140,302,642 (GRCm39) I271F probably damaging Het
Aspm T A 1: 139,407,584 (GRCm39) M2157K possibly damaging Het
Capn13 G A 17: 73,629,049 (GRCm39) S586L probably benign Het
Cd3g A T 9: 44,885,459 (GRCm39) probably null Het
Cfap54 A T 10: 92,704,603 (GRCm39) Y2826N unknown Het
Cmas T C 6: 142,710,283 (GRCm39) V134A probably damaging Het
Cnp A G 11: 100,469,814 (GRCm39) H250R probably damaging Het
Dact1 G A 12: 71,364,688 (GRCm39) A453T probably benign Het
Dcaf6 T A 1: 165,179,623 (GRCm39) R506* probably null Het
Dph1 A G 11: 75,081,272 (GRCm39) V5A probably benign Het
Entpd3 A G 9: 120,387,568 (GRCm39) Y255C probably damaging Het
Etl4 A T 2: 20,811,957 (GRCm39) T1715S probably damaging Het
Exd2 T A 12: 80,539,334 (GRCm39) H466Q probably damaging Het
Fbln2 A G 6: 91,246,181 (GRCm39) N1056S probably damaging Het
Fcrl5 A T 3: 87,351,502 (GRCm39) Q250L possibly damaging Het
Fignl2 A G 15: 100,951,301 (GRCm39) V327A unknown Het
Gm10226 T A 17: 21,910,866 (GRCm39) C34S possibly damaging Het
H2bc6 A T 13: 23,769,938 (GRCm39) M1K probably null Het
Kdm6b A G 11: 69,296,960 (GRCm39) S436P possibly damaging Het
Lmnb2 G T 10: 80,753,991 (GRCm39) A21E possibly damaging Het
Mcf2l A T 8: 12,930,127 (GRCm39) E49V probably benign Het
Muc2 A G 7: 141,290,942 (GRCm39) E76G Het
Naa60 T C 16: 3,718,573 (GRCm39) I135T probably benign Het
Neb T C 2: 52,097,713 (GRCm39) Y4924C possibly damaging Het
Nlrp10 T A 7: 108,524,656 (GRCm39) I275F probably damaging Het
Nr3c2 T C 8: 77,636,174 (GRCm39) V425A possibly damaging Het
Nucb2 T A 7: 116,128,248 (GRCm39) D286E probably damaging Het
Nynrin G A 14: 56,103,420 (GRCm39) G755S probably damaging Het
Or5d41 T C 2: 88,054,429 (GRCm39) T316A probably damaging Het
Padi2 T A 4: 140,651,656 (GRCm39) D135E probably benign Het
Pcdha6 T A 18: 37,103,034 (GRCm39) S742R probably benign Het
Pcdhgb5 T A 18: 37,866,007 (GRCm39) S601T probably damaging Het
Pira13 T C 7: 3,826,246 (GRCm39) N249S unknown Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Prr15l T C 11: 96,825,390 (GRCm39) W7R possibly damaging Het
Ptpn23 G A 9: 110,215,368 (GRCm39) H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 (GRCm39) Q286* probably null Het
Rptor T C 11: 119,783,453 (GRCm39) I1149T probably benign Het
Sfrp2 A G 3: 83,674,086 (GRCm39) I80V probably benign Het
Slc38a2 T C 15: 96,588,033 (GRCm39) D497G probably benign Het
Slc43a1 T A 2: 84,671,197 (GRCm39) M44K probably damaging Het
Stil T A 4: 114,890,035 (GRCm39) V841E possibly damaging Het
Stip1 T A 19: 6,999,141 (GRCm39) H479L probably benign Het
Supt6 A G 11: 78,100,355 (GRCm39) Y1486H probably damaging Het
Taf6 T C 5: 138,180,282 (GRCm39) D324G probably damaging Het
Tgif1 T A 17: 71,158,452 (GRCm39) probably benign Het
Tmprss11f T C 5: 86,681,605 (GRCm39) E216G probably benign Het
Tmprss7 C A 16: 45,488,014 (GRCm39) A472S probably benign Het
Tspan12 T A 6: 21,836,442 (GRCm39) N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,376,120 (GRCm39) probably null Het
Unc13c A T 9: 73,602,232 (GRCm39) I1338N probably damaging Het
Vegfc T A 8: 54,530,835 (GRCm39) S8T unknown Het
Vmn1r59 T A 7: 5,457,634 (GRCm39) Q42L probably damaging Het
Vmn2r-ps117 A T 17: 19,043,934 (GRCm39) I337F probably damaging Het
Xylb G A 9: 119,209,766 (GRCm39) probably null Het
Zfp551 T A 7: 12,152,569 (GRCm39) I55F probably damaging Het
Zfp972 T C 2: 177,563,532 (GRCm39) N27S probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGACAGATGTAATTCACTTTGTC -3'
(R):5'- TGAATTTCAACACCCTGCGC -3'

Sequencing Primer
(F):5'- GAAATGTGACCCTTTTTGCTCCAG -3'
(R):5'- TCAACACCCTGCGCAGAGTG -3'
Posted On 2019-11-26