Mutagenetix > Incidental Mutation

Incidental Mutation 'R7776:Muc2'

598895

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R7776 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141704393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 76 (E76G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,232,991		probably null	Het
Abca3	T	A	17: 24,386,276	V716D	possibly damaging	Het
Adprhl1	C	T	8: 13,248,682	V83I	probably damaging	Het
Alkbh1	A	G	12: 87,431,445	V232A	probably damaging	Het
Arhgef10l	T	A	4: 140,575,331	I271F	probably damaging	Het
Aspm	T	A	1: 139,479,846	M2157K	possibly damaging	Het
Capn13	G	A	17: 73,322,054	S586L	probably benign	Het
Cd3g	A	T	9: 44,974,161		probably null	Het
Cfap54	A	T	10: 92,868,741	Y2826N	unknown	Het
Cmas	T	C	6: 142,764,557	V134A	probably damaging	Het
Cnp	A	G	11: 100,578,988	H250R	probably damaging	Het
Dact1	G	A	12: 71,317,914	A453T	probably benign	Het
Dcaf6	T	A	1: 165,352,054	R506*	probably null	Het
Dph1	A	G	11: 75,190,446	V5A	probably benign	Het
Entpd3	A	G	9: 120,558,502	Y255C	probably damaging	Het
Etl4	A	T	2: 20,807,146	T1715S	probably damaging	Het
Exd2	T	A	12: 80,492,560	H466Q	probably damaging	Het
Fbln2	A	G	6: 91,269,199	N1056S	probably damaging	Het
Fcrl5	A	T	3: 87,444,195	Q250L	possibly damaging	Het
Fignl2	A	G	15: 101,053,420	V327A	unknown	Het
Gm10226	T	A	17: 21,691,959	C34S	possibly damaging	Het
Gm15448	T	C	7: 3,823,247	N249S	unknown	Het
Hist1h2be	A	T	13: 23,585,955	M1K	probably null	Het
Kdm6b	A	G	11: 69,406,134	S436P	possibly damaging	Het
Lmnb2	G	T	10: 80,918,157	A21E	possibly damaging	Het
Mcf2l	A	T	8: 12,880,127	E49V	probably benign	Het
Naa60	T	C	16: 3,900,709	I135T	probably benign	Het
Neb	T	C	2: 52,207,701	Y4924C	possibly damaging	Het
Nlrp10	T	A	7: 108,925,449	I275F	probably damaging	Het
Nr3c2	T	C	8: 76,909,545	V425A	possibly damaging	Het
Nucb2	T	A	7: 116,529,013	D286E	probably damaging	Het
Nynrin	G	A	14: 55,865,963	G755S	probably damaging	Het
Olfr1170	T	C	2: 88,224,085	T316A	probably damaging	Het
Padi2	T	A	4: 140,924,345	D135E	probably benign	Het
Pcdha6	T	A	18: 36,969,981	S742R	probably benign	Het
Pcdhgb5	T	A	18: 37,732,954	S601T	probably damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Prr15l	T	C	11: 96,934,564	W7R	possibly damaging	Het
Ptpn23	G	A	9: 110,386,300	H1431Y	possibly damaging	Het
Rnf20	C	T	4: 49,644,592	Q286*	probably null	Het
Rptor	T	C	11: 119,892,627	I1149T	probably benign	Het
Sfrp2	A	G	3: 83,766,779	I80V	probably benign	Het
Slc38a2	T	C	15: 96,690,152	D497G	probably benign	Het
Slc43a1	T	A	2: 84,840,853	M44K	probably damaging	Het
Stil	T	A	4: 115,032,838	V841E	possibly damaging	Het
Stip1	T	A	19: 7,021,773	H479L	probably benign	Het
Supt6	A	G	11: 78,209,529	Y1486H	probably damaging	Het
Taf6	T	C	5: 138,182,020	D324G	probably damaging	Het
Tgif1	T	A	17: 70,851,457		probably benign	Het
Tmprss11f	T	C	5: 86,533,746	E216G	probably benign	Het
Tmprss7	C	A	16: 45,667,651	A472S	probably benign	Het
Trpm1	T	A	7: 64,248,191	F1191I	probably benign	Het
Tspan12	T	A	6: 21,836,443	N40I	probably damaging	Het
Ttll3	AAGTA	AAGTACAGTA	6: 113,399,159		probably null	Het
Unc13c	A	T	9: 73,694,950	I1338N	probably damaging	Het
Vegfc	T	A	8: 54,077,800	S8T	unknown	Het
Vmn1r59	T	A	7: 5,454,635	Q42L	probably damaging	Het
Vmn2r-ps117	A	T	17: 18,823,672	I337F	probably damaging	Het
Xylb	G	A	9: 119,380,700		probably null	Het
Zfp551	T	A	7: 12,418,642	I55F	probably damaging	Het
Zfp972	T	C	2: 177,921,739	N27S	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- AGGACTCTGAATCACCCAGC -3'
(R):5'- TTGGTAAAGTAGCAGATGAAGTCAC -3'

Sequencing Primer
(F):5'- GGTCTGACTGGATCAACAAATATC -3'
(R):5'- TAGCAGATGAAGTCACTGGGG -3'

Posted On

2019-11-26