Incidental Mutation 'R7776:Unc13c'
ID598901
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7776 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73694950 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1338 (I1338N)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: I1338N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: I1338N

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: I1338N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: I1338N

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,232,991 probably null Het
Abca3 T A 17: 24,386,276 V716D possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Alkbh1 A G 12: 87,431,445 V232A probably damaging Het
Arhgef10l T A 4: 140,575,331 I271F probably damaging Het
Aspm T A 1: 139,479,846 M2157K possibly damaging Het
Capn13 G A 17: 73,322,054 S586L probably benign Het
Cd3g A T 9: 44,974,161 probably null Het
Cfap54 A T 10: 92,868,741 Y2826N unknown Het
Cmas T C 6: 142,764,557 V134A probably damaging Het
Cnp A G 11: 100,578,988 H250R probably damaging Het
Dact1 G A 12: 71,317,914 A453T probably benign Het
Dcaf6 T A 1: 165,352,054 R506* probably null Het
Dph1 A G 11: 75,190,446 V5A probably benign Het
Entpd3 A G 9: 120,558,502 Y255C probably damaging Het
Etl4 A T 2: 20,807,146 T1715S probably damaging Het
Exd2 T A 12: 80,492,560 H466Q probably damaging Het
Fbln2 A G 6: 91,269,199 N1056S probably damaging Het
Fcrl5 A T 3: 87,444,195 Q250L possibly damaging Het
Fignl2 A G 15: 101,053,420 V327A unknown Het
Gm10226 T A 17: 21,691,959 C34S possibly damaging Het
Gm15448 T C 7: 3,823,247 N249S unknown Het
Hist1h2be A T 13: 23,585,955 M1K probably null Het
Kdm6b A G 11: 69,406,134 S436P possibly damaging Het
Lmnb2 G T 10: 80,918,157 A21E possibly damaging Het
Mcf2l A T 8: 12,880,127 E49V probably benign Het
Muc2 A G 7: 141,704,393 E76G Het
Naa60 T C 16: 3,900,709 I135T probably benign Het
Neb T C 2: 52,207,701 Y4924C possibly damaging Het
Nlrp10 T A 7: 108,925,449 I275F probably damaging Het
Nr3c2 T C 8: 76,909,545 V425A possibly damaging Het
Nucb2 T A 7: 116,529,013 D286E probably damaging Het
Nynrin G A 14: 55,865,963 G755S probably damaging Het
Olfr1170 T C 2: 88,224,085 T316A probably damaging Het
Padi2 T A 4: 140,924,345 D135E probably benign Het
Pcdha6 T A 18: 36,969,981 S742R probably benign Het
Pcdhgb5 T A 18: 37,732,954 S601T probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prr15l T C 11: 96,934,564 W7R possibly damaging Het
Ptpn23 G A 9: 110,386,300 H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 Q286* probably null Het
Rptor T C 11: 119,892,627 I1149T probably benign Het
Sfrp2 A G 3: 83,766,779 I80V probably benign Het
Slc38a2 T C 15: 96,690,152 D497G probably benign Het
Slc43a1 T A 2: 84,840,853 M44K probably damaging Het
Stil T A 4: 115,032,838 V841E possibly damaging Het
Stip1 T A 19: 7,021,773 H479L probably benign Het
Supt6 A G 11: 78,209,529 Y1486H probably damaging Het
Taf6 T C 5: 138,182,020 D324G probably damaging Het
Tgif1 T A 17: 70,851,457 probably benign Het
Tmprss11f T C 5: 86,533,746 E216G probably benign Het
Tmprss7 C A 16: 45,667,651 A472S probably benign Het
Trpm1 T A 7: 64,248,191 F1191I probably benign Het
Tspan12 T A 6: 21,836,443 N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,399,159 probably null Het
Vegfc T A 8: 54,077,800 S8T unknown Het
Vmn1r59 T A 7: 5,454,635 Q42L probably damaging Het
Vmn2r-ps117 A T 17: 18,823,672 I337F probably damaging Het
Xylb G A 9: 119,380,700 probably null Het
Zfp551 T A 7: 12,418,642 I55F probably damaging Het
Zfp972 T C 2: 177,921,739 N27S probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTATGACTTTTCAAAACCCAGTGC -3'
(R):5'- AAAACTAGTCACAGTGGTCCCC -3'

Sequencing Primer
(F):5'- CAAAACCCAGTGCTTATTTTGTG -3'
(R):5'- AGTGGTCCCCTGAGTCTCTCAATAG -3'
Posted On2019-11-26