Incidental Mutation 'R7776:Lmnb2'
ID598905
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Namelamin B2
Synonymslamin B3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7776 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80901203-80918245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80918157 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 21 (A21E)
Ref Sequence ENSEMBL: ENSMUSP00000057291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057623] [ENSMUST00000179022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057623
AA Change: A21E

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: A21E

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179022
AA Change: A2E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: A2E

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,232,991 probably null Het
Abca3 T A 17: 24,386,276 V716D possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Alkbh1 A G 12: 87,431,445 V232A probably damaging Het
Arhgef10l T A 4: 140,575,331 I271F probably damaging Het
Aspm T A 1: 139,479,846 M2157K possibly damaging Het
Capn13 G A 17: 73,322,054 S586L probably benign Het
Cd3g A T 9: 44,974,161 probably null Het
Cfap54 A T 10: 92,868,741 Y2826N unknown Het
Cmas T C 6: 142,764,557 V134A probably damaging Het
Cnp A G 11: 100,578,988 H250R probably damaging Het
Dact1 G A 12: 71,317,914 A453T probably benign Het
Dcaf6 T A 1: 165,352,054 R506* probably null Het
Dph1 A G 11: 75,190,446 V5A probably benign Het
Entpd3 A G 9: 120,558,502 Y255C probably damaging Het
Etl4 A T 2: 20,807,146 T1715S probably damaging Het
Exd2 T A 12: 80,492,560 H466Q probably damaging Het
Fbln2 A G 6: 91,269,199 N1056S probably damaging Het
Fcrl5 A T 3: 87,444,195 Q250L possibly damaging Het
Fignl2 A G 15: 101,053,420 V327A unknown Het
Gm10226 T A 17: 21,691,959 C34S possibly damaging Het
Gm15448 T C 7: 3,823,247 N249S unknown Het
Hist1h2be A T 13: 23,585,955 M1K probably null Het
Kdm6b A G 11: 69,406,134 S436P possibly damaging Het
Mcf2l A T 8: 12,880,127 E49V probably benign Het
Muc2 A G 7: 141,704,393 E76G Het
Naa60 T C 16: 3,900,709 I135T probably benign Het
Neb T C 2: 52,207,701 Y4924C possibly damaging Het
Nlrp10 T A 7: 108,925,449 I275F probably damaging Het
Nr3c2 T C 8: 76,909,545 V425A possibly damaging Het
Nucb2 T A 7: 116,529,013 D286E probably damaging Het
Nynrin G A 14: 55,865,963 G755S probably damaging Het
Olfr1170 T C 2: 88,224,085 T316A probably damaging Het
Padi2 T A 4: 140,924,345 D135E probably benign Het
Pcdha6 T A 18: 36,969,981 S742R probably benign Het
Pcdhgb5 T A 18: 37,732,954 S601T probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prr15l T C 11: 96,934,564 W7R possibly damaging Het
Ptpn23 G A 9: 110,386,300 H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 Q286* probably null Het
Rptor T C 11: 119,892,627 I1149T probably benign Het
Sfrp2 A G 3: 83,766,779 I80V probably benign Het
Slc38a2 T C 15: 96,690,152 D497G probably benign Het
Slc43a1 T A 2: 84,840,853 M44K probably damaging Het
Stil T A 4: 115,032,838 V841E possibly damaging Het
Stip1 T A 19: 7,021,773 H479L probably benign Het
Supt6 A G 11: 78,209,529 Y1486H probably damaging Het
Taf6 T C 5: 138,182,020 D324G probably damaging Het
Tgif1 T A 17: 70,851,457 probably benign Het
Tmprss11f T C 5: 86,533,746 E216G probably benign Het
Tmprss7 C A 16: 45,667,651 A472S probably benign Het
Trpm1 T A 7: 64,248,191 F1191I probably benign Het
Tspan12 T A 6: 21,836,443 N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,399,159 probably null Het
Unc13c A T 9: 73,694,950 I1338N probably damaging Het
Vegfc T A 8: 54,077,800 S8T unknown Het
Vmn1r59 T A 7: 5,454,635 Q42L probably damaging Het
Vmn2r-ps117 A T 17: 18,823,672 I337F probably damaging Het
Xylb G A 9: 119,380,700 probably null Het
Zfp551 T A 7: 12,418,642 I55F probably damaging Het
Zfp972 T C 2: 177,921,739 N27S probably benign Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCATTTCACCTATCACCAGG -3'
(R):5'- ACTACATCTCCTGGCATGCC -3'

Sequencing Primer
(F):5'- TTTCACCTATCACCAGGATCAAG -3'
(R):5'- TCCTGGCATGCCTCGCAAG -3'
Posted On2019-11-26