Incidental Mutation 'R7776:Cnp'
ID 598911
Institutional Source Beutler Lab
Gene Symbol Cnp
Ensembl Gene ENSMUSG00000006782
Gene Name 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms Cnp1, CNPase, Cnp-1
MMRRC Submission 045832-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100465765-100472565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100469814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 250 (H250R)
Ref Sequence ENSEMBL: ENSMUSP00000099409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000103120]
AlphaFold P16330
PDB Structure Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with sulfate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic NADP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with GTP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic AMP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3-(SP)-Cyclic-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3'- cyclic AMP [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000014339
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103120
AA Change: H250R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782
AA Change: H250R

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in ataxia, gait abnormalities, hindlimb paralysis, muscle weakness, convulsive seizures, weight loss, kyphosis, reactive gliosis, axonal swellings and degeneration, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,832,214 (GRCm39) probably null Het
Abca3 T A 17: 24,605,250 (GRCm39) V716D possibly damaging Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Alkbh1 A G 12: 87,478,215 (GRCm39) V232A probably damaging Het
Arhgef10l T A 4: 140,302,642 (GRCm39) I271F probably damaging Het
Aspm T A 1: 139,407,584 (GRCm39) M2157K possibly damaging Het
Capn13 G A 17: 73,629,049 (GRCm39) S586L probably benign Het
Cd3g A T 9: 44,885,459 (GRCm39) probably null Het
Cfap54 A T 10: 92,704,603 (GRCm39) Y2826N unknown Het
Cmas T C 6: 142,710,283 (GRCm39) V134A probably damaging Het
Dact1 G A 12: 71,364,688 (GRCm39) A453T probably benign Het
Dcaf6 T A 1: 165,179,623 (GRCm39) R506* probably null Het
Dph1 A G 11: 75,081,272 (GRCm39) V5A probably benign Het
Entpd3 A G 9: 120,387,568 (GRCm39) Y255C probably damaging Het
Etl4 A T 2: 20,811,957 (GRCm39) T1715S probably damaging Het
Exd2 T A 12: 80,539,334 (GRCm39) H466Q probably damaging Het
Fbln2 A G 6: 91,246,181 (GRCm39) N1056S probably damaging Het
Fcrl5 A T 3: 87,351,502 (GRCm39) Q250L possibly damaging Het
Fignl2 A G 15: 100,951,301 (GRCm39) V327A unknown Het
Gm10226 T A 17: 21,910,866 (GRCm39) C34S possibly damaging Het
H2bc6 A T 13: 23,769,938 (GRCm39) M1K probably null Het
Kdm6b A G 11: 69,296,960 (GRCm39) S436P possibly damaging Het
Lmnb2 G T 10: 80,753,991 (GRCm39) A21E possibly damaging Het
Mcf2l A T 8: 12,930,127 (GRCm39) E49V probably benign Het
Muc2 A G 7: 141,290,942 (GRCm39) E76G Het
Naa60 T C 16: 3,718,573 (GRCm39) I135T probably benign Het
Neb T C 2: 52,097,713 (GRCm39) Y4924C possibly damaging Het
Nlrp10 T A 7: 108,524,656 (GRCm39) I275F probably damaging Het
Nr3c2 T C 8: 77,636,174 (GRCm39) V425A possibly damaging Het
Nucb2 T A 7: 116,128,248 (GRCm39) D286E probably damaging Het
Nynrin G A 14: 56,103,420 (GRCm39) G755S probably damaging Het
Or5d41 T C 2: 88,054,429 (GRCm39) T316A probably damaging Het
Padi2 T A 4: 140,651,656 (GRCm39) D135E probably benign Het
Pcdha6 T A 18: 37,103,034 (GRCm39) S742R probably benign Het
Pcdhgb5 T A 18: 37,866,007 (GRCm39) S601T probably damaging Het
Pira13 T C 7: 3,826,246 (GRCm39) N249S unknown Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Prr15l T C 11: 96,825,390 (GRCm39) W7R possibly damaging Het
Ptpn23 G A 9: 110,215,368 (GRCm39) H1431Y possibly damaging Het
Rnf20 C T 4: 49,644,592 (GRCm39) Q286* probably null Het
Rptor T C 11: 119,783,453 (GRCm39) I1149T probably benign Het
Sfrp2 A G 3: 83,674,086 (GRCm39) I80V probably benign Het
Slc38a2 T C 15: 96,588,033 (GRCm39) D497G probably benign Het
Slc43a1 T A 2: 84,671,197 (GRCm39) M44K probably damaging Het
Stil T A 4: 114,890,035 (GRCm39) V841E possibly damaging Het
Stip1 T A 19: 6,999,141 (GRCm39) H479L probably benign Het
Supt6 A G 11: 78,100,355 (GRCm39) Y1486H probably damaging Het
Taf6 T C 5: 138,180,282 (GRCm39) D324G probably damaging Het
Tgif1 T A 17: 71,158,452 (GRCm39) probably benign Het
Tmprss11f T C 5: 86,681,605 (GRCm39) E216G probably benign Het
Tmprss7 C A 16: 45,488,014 (GRCm39) A472S probably benign Het
Trpm1 T A 7: 63,897,939 (GRCm39) F1191I probably benign Het
Tspan12 T A 6: 21,836,442 (GRCm39) N40I probably damaging Het
Ttll3 AAGTA AAGTACAGTA 6: 113,376,120 (GRCm39) probably null Het
Unc13c A T 9: 73,602,232 (GRCm39) I1338N probably damaging Het
Vegfc T A 8: 54,530,835 (GRCm39) S8T unknown Het
Vmn1r59 T A 7: 5,457,634 (GRCm39) Q42L probably damaging Het
Vmn2r-ps117 A T 17: 19,043,934 (GRCm39) I337F probably damaging Het
Xylb G A 9: 119,209,766 (GRCm39) probably null Het
Zfp551 T A 7: 12,152,569 (GRCm39) I55F probably damaging Het
Zfp972 T C 2: 177,563,532 (GRCm39) N27S probably benign Het
Other mutations in Cnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Cnp APN 11 100,467,525 (GRCm39) missense probably benign 0.25
R0004:Cnp UTSW 11 100,467,633 (GRCm39) missense probably damaging 1.00
R0004:Cnp UTSW 11 100,467,633 (GRCm39) missense probably damaging 1.00
R0015:Cnp UTSW 11 100,469,734 (GRCm39) splice site probably null
R0015:Cnp UTSW 11 100,469,734 (GRCm39) splice site probably null
R0546:Cnp UTSW 11 100,471,549 (GRCm39) missense probably damaging 1.00
R2384:Cnp UTSW 11 100,467,279 (GRCm39) missense probably damaging 1.00
R4653:Cnp UTSW 11 100,467,342 (GRCm39) missense probably benign 0.19
R4654:Cnp UTSW 11 100,469,877 (GRCm39) missense possibly damaging 0.90
R4898:Cnp UTSW 11 100,467,202 (GRCm39) missense probably benign 0.11
R5559:Cnp UTSW 11 100,467,243 (GRCm39) missense probably damaging 1.00
R7045:Cnp UTSW 11 100,471,184 (GRCm39) missense probably benign 0.00
R7225:Cnp UTSW 11 100,471,413 (GRCm39) nonsense probably null
R8350:Cnp UTSW 11 100,467,267 (GRCm39) missense probably damaging 1.00
R8450:Cnp UTSW 11 100,467,267 (GRCm39) missense probably damaging 1.00
R9616:Cnp UTSW 11 100,467,261 (GRCm39) missense probably benign 0.04
R9784:Cnp UTSW 11 100,467,437 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTTAGTAATGGCCCTGG -3'
(R):5'- TCAAGGAGAAGGCCCTTTGG -3'

Sequencing Primer
(F):5'- ACTTCTTAGTAATGGCCCTGGTTTTG -3'
(R):5'- GGACTAGTGAGGCCCTAGG -3'
Posted On 2019-11-26