Incidental Mutation 'R7777:Plcb1'
ID598936
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135220757 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 96 (G96R)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070724
AA Change: G96R

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: G96R

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110116
AA Change: G96R

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: G96R

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131552
AA Change: G96R

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: G96R

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201485
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCAGTCACTGTAAAATGGAAGAC -3'
(R):5'- TTCAGATGGCAGCTTAACCC -3'

Sequencing Primer
(F):5'- GGCAGTTCTACTTCTAGTTC -3'
(R):5'- GATGGCAGCTTAACCCAAACTAC -3'
Posted On2019-11-26