Mutagenetix > Incidental Mutation

Incidental Mutation 'R7777:Plcg1'

598937

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7777 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160754603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 681 (M681V)

Ref Sequence

ENSEMBL: ENSMUSP00000099404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

AlphaFold

Q62077

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103115
AA Change: M681V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: M681V

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109462
AA Change: M681V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: M681V

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	T	4: 42,970,171	Q53*	probably null	Het
1700022I11Rik	T	C	4: 42,971,095	S143P	probably benign	Het
Adam6b	C	T	12: 113,490,138	P192S	possibly damaging	Het
Arhgef10	A	G	8: 14,945,373	T353A	probably damaging	Het
Cabyr	A	G	18: 12,744,771	D55G	probably damaging	Het
Dcaf4	T	C	12: 83,537,959	V322A	probably damaging	Het
Ephb2	T	A	4: 136,771,636	E44V	possibly damaging	Het
Fam3c	T	C	6: 22,328,574	I105V	probably benign	Het
Fras1	A	G	5: 96,752,904	D2994G	probably damaging	Het
Fryl	C	T	5: 73,071,298	D1697N	probably damaging	Het
Gapdh	A	T	6: 125,162,948	Y164*	probably null	Het
Gm4353	T	G	7: 116,083,763	Q194H	possibly damaging	Het
Ilvbl	T	A	10: 78,577,251		probably null	Het
Ism2	T	A	12: 87,286,884		probably null	Het
Jak2	C	T	19: 29,276,868	T196I	probably benign	Het
Lcor	T	G	19: 41,558,795	Y273D	probably benign	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Lysmd4	T	A	7: 67,223,698	M27K	possibly damaging	Het
Muc3	G	A	5: 137,146,716		silent	Het
Olfr1023	A	G	2: 85,887,607	E269G	possibly damaging	Het
Olfr539	T	A	7: 140,667,941	I211N	probably benign	Het
Olfr747	A	T	14: 50,680,804	Y277N	probably damaging	Het
Oscp1	T	C	4: 126,064,981		probably null	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Pkd2l2	C	A	18: 34,416,860	P186Q	probably damaging	Het
Plcb1	G	A	2: 135,220,757	G96R	possibly damaging	Het
Plcd3	G	C	11: 103,074,655	R535G	probably benign	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Polrmt	A	T	10: 79,739,188	D836E	probably benign	Het
Pramef8	T	C	4: 143,417,761	Y226H	possibly damaging	Het
Prkag1	A	T	15: 98,814,597	I149N	probably damaging	Het
Prkci	A	T	3: 31,050,213	Q575L	possibly damaging	Het
Prss40	C	T	1: 34,552,765	W276*	probably null	Het
Ptprn	T	C	1: 75,252,302	D823G	possibly damaging	Het
Radil	A	C	5: 142,543,548	F131C	probably damaging	Het
Rif1	A	G	2: 52,116,356	I550V	probably benign	Het
Rmnd1	T	C	10: 4,411,713	E320G	probably damaging	Het
Sec31b	T	A	19: 44,523,773	K561*	probably null	Het
Tbx5	A	C	5: 119,883,167	T413P	probably benign	Het
Tmprss7	A	G	16: 45,660,600		probably null	Het
Tnfaip8l2	T	C	3: 95,139,996	*185W	probably null	Het
Tpst2	A	G	5: 112,309,694	E296G	possibly damaging	Het
Ubn2	T	A	6: 38,490,753	S801T	probably damaging	Het
Usp34	A	G	11: 23,382,638	S1141G		Het
Uts2r	A	G	11: 121,161,453	N381S	probably benign	Het
Vmn2r44	G	T	7: 8,378,315	T193K	possibly damaging	Het
Wdr18	T	A	10: 79,966,050	M223K	probably benign	Het
Wdr64	T	C	1: 175,789,998	C715R	possibly damaging	Het
Zfp672	A	G	11: 58,317,255	F80S	possibly damaging	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1719:Plcg1	UTSW	2	160753743	missense	probably null	0.94
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R2698:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6304:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7137:Plcg1	UTSW	2	160753926	missense	possibly damaging	0.83
R7155:Plcg1	UTSW	2	160754380	missense	probably damaging	1.00
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
R8708:Plcg1	UTSW	2	160754553	splice site	probably benign
R8831:Plcg1	UTSW	2	160747812	missense	probably benign	0.02
R8936:Plcg1	UTSW	2	160748066	missense	probably benign	0.02
R9414:Plcg1	UTSW	2	160761356	missense	possibly damaging	0.80
R9466:Plcg1	UTSW	2	160754600	missense	probably benign
R9608:Plcg1	UTSW	2	160755751	missense	probably benign	0.02
R9755:Plcg1	UTSW	2	160731860	missense	probably benign	0.27
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCTGCAATGAGTTTGAGATGC -3'
(R):5'- AGCATCACTGTCTGGCCTTC -3'

Sequencing Primer
(F):5'- TGAGATGCGCCTTTCAGAGC -3'
(R):5'- ACTCGGCAGTGCTTGATC -3'

Posted On

2019-11-26