Incidental Mutation 'R7777:Prkci'
ID598938
Institutional Source Beutler Lab
Gene Symbol Prkci
Ensembl Gene ENSMUSG00000037643
Gene Nameprotein kinase C, iota
SynonymsPkci, 2310021H13Rik, Prkcl, aPKClambda, PKClambda, Pkcl
Accession Numbers

Genbank: NM_008857

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7777 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location30995747-31052959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31050213 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 575 (Q575L)
Ref Sequence ENSEMBL: ENSMUSP00000103884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108249]
PDB Structure
Structure of PKC in Complex with a Substrate Peptide from Par-3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108249
AA Change: Q575L

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103884
Gene: ENSMUSG00000037643
AA Change: Q575L

DomainStartEndE-ValueType
PB1 25 106 7.62e-26 SMART
C1 141 190 3.7e-14 SMART
S_TKc 253 521 4.29e-96 SMART
S_TK_X 522 585 3.6e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein kinase C (PKC) family of serine/threonine protein kinases. The PKC family comprises at least eight members, which are differentially expressed and are involved in a wide variety of cellular processes. This protein kinase is calcium-independent and phospholipid-dependent. It is not activated by phorbolesters or diacylglycerol. This kinase can be recruited to vesicle tubular clusters (VTCs) by direct interaction with the small GTPase RAB2, where this kinase phosphorylates glyceraldehyde-3-phosphate dehydrogenase (GAPD/GAPDH) and plays a role in microtubule dynamics in the early secretory pathway. This kinase is found to be necessary for BCL-ABL-mediated resistance to drug-induced apoptosis and therefore protects leukemia cells against drug-induced apoptosis. There is a single exon pseudogene mapped on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Muscle-specific deletion of this gene impairs glucose transport and induces metabolic and diabetic syndromes. Podocyte-specific deletion leads to altered podocyte architecture, proteinuria, and accelerated renal failure. [provided by MGI curators]
Allele List at MGI

 All alleles(111) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(107)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y not run Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Prkci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Prkci APN 3 31034499 missense probably benign 0.13
IGL01472:Prkci APN 3 31050192 missense probably damaging 0.99
3-1:Prkci UTSW 3 31039070 missense probably damaging 0.97
R0584:Prkci UTSW 3 31025140 nonsense probably null
R0699:Prkci UTSW 3 31050273 missense possibly damaging 0.94
R1077:Prkci UTSW 3 31050192 missense probably damaging 0.99
R1483:Prkci UTSW 3 31043792 missense probably damaging 1.00
R1815:Prkci UTSW 3 31038495 missense probably damaging 1.00
R2325:Prkci UTSW 3 31031068 intron probably null
R4997:Prkci UTSW 3 31031226 critical splice donor site probably null
R5973:Prkci UTSW 3 31038456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTCGGTTATAAGGTTGG -3'
(R):5'- GTCTCCAACAGGATACCGAG -3'

Sequencing Primer
(F):5'- GCTCTTAGTCTTCTTGTGAGGC -3'
(R):5'- ATACCGAGAGCGACTTCTGCAG -3'
Posted On2019-11-26