Incidental Mutation 'R7777:1700022I11Rik'
ID598941
Institutional Source Beutler Lab
Gene Symbol 1700022I11Rik
Ensembl Gene ENSMUSG00000028451
Gene NameRIKEN cDNA 1700022I11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location42969604-42983640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42971095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
Predicted Effect probably benign
Transcript: ENSMUST00000030163
AA Change: S143P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: S143P

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
AA Change: S83P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451
AA Change: S83P

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190902
AA Change: S107P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in 1700022I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:1700022I11Rik APN 4 42973982 missense probably benign 0.40
IGL01340:1700022I11Rik APN 4 42971984 missense possibly damaging 0.94
IGL02078:1700022I11Rik APN 4 42972685 missense possibly damaging 0.71
IGL02082:1700022I11Rik APN 4 42970198 missense probably benign 0.00
IGL02993:1700022I11Rik APN 4 42971719 missense probably damaging 0.99
IGL03174:1700022I11Rik APN 4 42970975 missense probably benign 0.00
IGL03188:1700022I11Rik APN 4 42971225 missense possibly damaging 0.56
R0031:1700022I11Rik UTSW 4 42973712 missense probably damaging 0.99
R0179:1700022I11Rik UTSW 4 42972214 missense probably benign 0.00
R0409:1700022I11Rik UTSW 4 42972203 missense probably damaging 0.98
R0422:1700022I11Rik UTSW 4 42972199 missense possibly damaging 0.95
R0462:1700022I11Rik UTSW 4 42973429 missense probably benign
R0467:1700022I11Rik UTSW 4 42972715 missense probably benign
R0677:1700022I11Rik UTSW 4 42970952 nonsense probably null
R0723:1700022I11Rik UTSW 4 42971691 missense probably damaging 0.98
R1479:1700022I11Rik UTSW 4 42972543 missense possibly damaging 0.55
R1586:1700022I11Rik UTSW 4 42971512 missense probably benign 0.03
R1956:1700022I11Rik UTSW 4 42970105 splice site probably null
R2030:1700022I11Rik UTSW 4 42974131 nonsense probably null
R2074:1700022I11Rik UTSW 4 42974171 missense probably benign 0.38
R2162:1700022I11Rik UTSW 4 42972238 missense possibly damaging 0.59
R2419:1700022I11Rik UTSW 4 42974146 missense possibly damaging 0.94
R2939:1700022I11Rik UTSW 4 42972946 missense probably benign 0.04
R3615:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3616:1700022I11Rik UTSW 4 42971864 missense probably benign 0.10
R3981:1700022I11Rik UTSW 4 42971534 missense probably damaging 0.99
R5037:1700022I11Rik UTSW 4 42972195 missense probably benign
R5252:1700022I11Rik UTSW 4 42971706 missense probably benign 0.00
R5526:1700022I11Rik UTSW 4 42972125 missense possibly damaging 0.90
R5642:1700022I11Rik UTSW 4 42971831 missense possibly damaging 0.61
R5935:1700022I11Rik UTSW 4 42971465 missense probably benign
R6082:1700022I11Rik UTSW 4 42972511 missense probably benign 0.27
R6136:1700022I11Rik UTSW 4 42972853 missense probably damaging 0.96
R6361:1700022I11Rik UTSW 4 42972695 missense probably benign 0.05
R6494:1700022I11Rik UTSW 4 42971924 missense possibly damaging 0.94
R6641:1700022I11Rik UTSW 4 42971245 missense possibly damaging 0.90
R7289:1700022I11Rik UTSW 4 42972379 missense probably benign 0.00
R7289:1700022I11Rik UTSW 4 42973252 missense possibly damaging 0.66
R7777:1700022I11Rik UTSW 4 42970171 nonsense probably null
R7893:1700022I11Rik UTSW 4 42971539 missense probably damaging 0.99
R8066:1700022I11Rik UTSW 4 42971929 missense possibly damaging 0.66
R8311:1700022I11Rik UTSW 4 42973169 missense probably benign 0.19
R8706:1700022I11Rik UTSW 4 42971776 missense probably benign 0.02
R8743:1700022I11Rik UTSW 4 42971030 missense probably benign 0.00
R8774:1700022I11Rik UTSW 4 42971087 missense probably damaging 1.00
R8774-TAIL:1700022I11Rik UTSW 4 42971087 missense probably damaging 1.00
R8806:1700022I11Rik UTSW 4 42971261 missense probably benign 0.37
R8916:1700022I11Rik UTSW 4 42973034 missense probably damaging 1.00
R8928:1700022I11Rik UTSW 4 42972251 missense probably benign 0.00
R8947:1700022I11Rik UTSW 4 42972097 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACAACTTCTGTACCATTTGGCC -3'
(R):5'- TTAGTGGAGAGGGACCATCTG -3'

Sequencing Primer
(F):5'- TTGCCTGTGGAAGCAAAAATC -3'
(R):5'- CTGAGCTCAGGAAAATAGTCTTCAAG -3'
Posted On2019-11-26