Incidental Mutation 'R7777:Oscp1'
ID598942
Institutional Source Beutler Lab
Gene Symbol Oscp1
Ensembl Gene ENSMUSG00000042616
Gene Nameorganic solute carrier partner 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126058565-126092195 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 126064981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035497] [ENSMUST00000143712]
Predicted Effect probably benign
Transcript: ENSMUST00000035497
SMART Domains Protein: ENSMUSP00000045241
Gene: ENSMUSG00000042616

DomainStartEndE-ValueType
Pfam:Oscp1 17 189 1.1e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143712
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Oscp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Oscp1 APN 4 126076808 missense probably damaging 1.00
R0584:Oscp1 UTSW 4 126083594 critical splice acceptor site probably null
R0655:Oscp1 UTSW 4 126058733 missense probably damaging 1.00
R1218:Oscp1 UTSW 4 126058739 missense probably benign 0.45
R1964:Oscp1 UTSW 4 126083622 missense possibly damaging 0.78
R4852:Oscp1 UTSW 4 126076859 missense possibly damaging 0.58
R4983:Oscp1 UTSW 4 126076762 missense probably benign 0.16
R5183:Oscp1 UTSW 4 126087729 missense probably damaging 1.00
R6525:Oscp1 UTSW 4 126076778 missense possibly damaging 0.77
R6918:Oscp1 UTSW 4 126076778 missense possibly damaging 0.77
R7022:Oscp1 UTSW 4 126082990 splice site probably null
R7198:Oscp1 UTSW 4 126086666 missense possibly damaging 0.51
R7483:Oscp1 UTSW 4 126073933 nonsense probably null
R7829:Oscp1 UTSW 4 126088408 missense probably benign 0.03
R8052:Oscp1 UTSW 4 126088323 missense possibly damaging 0.88
R8283:Oscp1 UTSW 4 126086600 missense probably benign
R8500:Oscp1 UTSW 4 126077410 missense possibly damaging 0.92
R8775:Oscp1 UTSW 4 126076826 missense probably benign 0.02
R8775-TAIL:Oscp1 UTSW 4 126076826 missense probably benign 0.02
R8871:Oscp1 UTSW 4 126058742 missense probably damaging 1.00
Z1177:Oscp1 UTSW 4 126073818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGTGTGCACATAAGCC -3'
(R):5'- TGTGGGGAGCCTTTCACATG -3'

Sequencing Primer
(F):5'- GAGTGTGCACATAAGCCATTTATTTC -3'
(R):5'- GCCAGAGCCTGCTAGGTTTTC -3'
Posted On2019-11-26