Incidental Mutation 'R7777:Tpst2'
ID598947
Institutional Source Beutler Lab
Gene Symbol Tpst2
Ensembl Gene ENSMUSG00000029344
Gene Nameprotein-tyrosine sulfotransferase 2
SynonymsD5Ucla3, grm, Tango13b, grt
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112276691-112315361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112309694 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 296 (E296G)
Ref Sequence ENSEMBL: ENSMUSP00000031287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031287] [ENSMUST00000071455] [ENSMUST00000151947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031287
AA Change: E296G

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031287
Gene: ENSMUSG00000029344
AA Change: E296G

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 272 8.8e-19 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071455
AA Change: E296G

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071399
Gene: ENSMUSG00000029344
AA Change: E296G

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 276 8.4e-16 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140262
SMART Domains Protein: ENSMUSP00000116816
Gene: ENSMUSG00000029344

DomainStartEndE-ValueType
PDB:3AP2|B 2 63 4e-36 PDB
SCOP:d1fmja_ 3 55 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151947
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show a delayed rise and a prolonged deficit of pituitary growth hormone resulting in delayed pubertal growth, hypothyroidism, and an enlarged adenohypophysis with aberrant chromophobic cells. Homozygous null mice show a modest but transient pubertal growth lag and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Tpst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Tpst2 APN 5 112309858 missense probably damaging 1.00
IGL03268:Tpst2 APN 5 112308225 missense probably damaging 1.00
blooming UTSW 5 112307757 missense probably benign
feldspar UTSW 5 112308305 nonsense probably null
gypsum UTSW 5 112308045 missense probably damaging 1.00
hot_springs UTSW 5 112307678 missense probably benign 0.05
R1175:Tpst2 UTSW 5 112308045 missense probably damaging 1.00
R1423:Tpst2 UTSW 5 112307622 missense probably benign 0.22
R1537:Tpst2 UTSW 5 112308420 missense possibly damaging 0.48
R2013:Tpst2 UTSW 5 112308014 missense probably damaging 1.00
R4624:Tpst2 UTSW 5 112308296 missense probably damaging 1.00
R4873:Tpst2 UTSW 5 112309821 nonsense probably null
R4875:Tpst2 UTSW 5 112309821 nonsense probably null
R5272:Tpst2 UTSW 5 112307952 missense probably damaging 1.00
R6123:Tpst2 UTSW 5 112308218 missense probably damaging 1.00
R6487:Tpst2 UTSW 5 112308123 missense probably damaging 1.00
R6605:Tpst2 UTSW 5 112276734 start gained probably benign
R6688:Tpst2 UTSW 5 112307757 missense probably benign
R7240:Tpst2 UTSW 5 112307678 missense probably benign 0.05
R7625:Tpst2 UTSW 5 112308021 missense probably damaging 1.00
R7797:Tpst2 UTSW 5 112307916 missense probably damaging 1.00
R8306:Tpst2 UTSW 5 112307937 missense probably damaging 1.00
R8486:Tpst2 UTSW 5 112308305 nonsense probably null
R8875:Tpst2 UTSW 5 112309848 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATCACTAGAGCACATGGC -3'
(R):5'- AATGTGTGCATACTCACCCGG -3'

Sequencing Primer
(F):5'- ATGGCTCCTGACCACAGCTC -3'
(R):5'- TGCATACTCACCCGGTGTGTG -3'
Posted On2019-11-26