Incidental Mutation 'R7777:Tbx5'
ID 598948
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene Name T-box 5
Synonyms
MMRRC Submission 045833-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.938) question?
Stock # R7777 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 119970733-120023284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 120021232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 413 (T413P)
Ref Sequence ENSEMBL: ENSMUSP00000018407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407]
AlphaFold P70326
Predicted Effect probably benign
Transcript: ENSMUST00000018407
AA Change: T413P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: T413P

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,758 (GRCm39) P192S possibly damaging Het
Arhgef10 A G 8: 14,995,373 (GRCm39) T353A probably damaging Het
Cabyr A G 18: 12,877,828 (GRCm39) D55G probably damaging Het
Dcaf4 T C 12: 83,584,733 (GRCm39) V322A probably damaging Het
Ephb2 T A 4: 136,498,947 (GRCm39) E44V possibly damaging Het
Fam3c T C 6: 22,328,573 (GRCm39) I105V probably benign Het
Fras1 A G 5: 96,900,763 (GRCm39) D2994G probably damaging Het
Fryl C T 5: 73,228,641 (GRCm39) D1697N probably damaging Het
Gapdh A T 6: 125,139,911 (GRCm39) Y164* probably null Het
Gm4353 T G 7: 115,682,998 (GRCm39) Q194H possibly damaging Het
Ilvbl T A 10: 78,413,085 (GRCm39) probably null Het
Ism2 T A 12: 87,333,658 (GRCm39) probably null Het
Jak2 C T 19: 29,254,268 (GRCm39) T196I probably benign Het
Lcor T G 19: 41,547,234 (GRCm39) Y273D probably benign Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lysmd4 T A 7: 66,873,446 (GRCm39) M27K possibly damaging Het
Muc17 G A 5: 137,175,564 (GRCm39) silent Het
Or11h4b A T 14: 50,918,261 (GRCm39) Y277N probably damaging Het
Or13a25 T A 7: 140,247,854 (GRCm39) I211N probably benign Het
Or5m10 A G 2: 85,717,951 (GRCm39) E269G possibly damaging Het
Oscp1 T C 4: 125,958,774 (GRCm39) probably null Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd2l2 C A 18: 34,549,913 (GRCm39) P186Q probably damaging Het
Plcb1 G A 2: 135,062,677 (GRCm39) G96R possibly damaging Het
Plcd3 G C 11: 102,965,481 (GRCm39) R535G probably benign Het
Plcg1 A G 2: 160,596,523 (GRCm39) M681V possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Polrmt A T 10: 79,575,022 (GRCm39) D836E probably benign Het
Pramel12 T C 4: 143,144,331 (GRCm39) Y226H possibly damaging Het
Prkag1 A T 15: 98,712,478 (GRCm39) I149N probably damaging Het
Prkci A T 3: 31,104,362 (GRCm39) Q575L possibly damaging Het
Prss40 C T 1: 34,591,846 (GRCm39) W276* probably null Het
Ptprn T C 1: 75,228,946 (GRCm39) D823G possibly damaging Het
Radil A C 5: 142,529,303 (GRCm39) F131C probably damaging Het
Rif1 A G 2: 52,006,368 (GRCm39) I550V probably benign Het
Rmnd1 T C 10: 4,361,713 (GRCm39) E320G probably damaging Het
Sec31b T A 19: 44,512,212 (GRCm39) K561* probably null Het
Spata31g1 C T 4: 42,970,171 (GRCm39) Q53* probably null Het
Spata31g1 T C 4: 42,971,095 (GRCm39) S143P probably benign Het
Tmprss7 A G 16: 45,480,963 (GRCm39) probably null Het
Tnfaip8l2 T C 3: 95,047,307 (GRCm39) *185W probably null Het
Tpst2 A G 5: 112,457,560 (GRCm39) E296G possibly damaging Het
Ubn2 T A 6: 38,467,688 (GRCm39) S801T probably damaging Het
Usp34 A G 11: 23,332,638 (GRCm39) S1141G Het
Uts2r A G 11: 121,052,279 (GRCm39) N381S probably benign Het
Vmn2r44 G T 7: 8,381,314 (GRCm39) T193K possibly damaging Het
Wdr18 T A 10: 79,801,884 (GRCm39) M223K probably benign Het
Wdr64 T C 1: 175,617,564 (GRCm39) C715R possibly damaging Het
Zfp672 A G 11: 58,208,081 (GRCm39) F80S possibly damaging Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 120,021,091 (GRCm39) missense probably benign
IGL01595:Tbx5 APN 5 119,978,903 (GRCm39) missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119,983,023 (GRCm39) unclassified probably benign
IGL02239:Tbx5 APN 5 120,009,345 (GRCm39) missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119,974,972 (GRCm39) utr 5 prime probably benign
IGL03326:Tbx5 APN 5 120,009,363 (GRCm39) missense probably damaging 0.99
R0477:Tbx5 UTSW 5 120,021,184 (GRCm39) missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 120,021,523 (GRCm39) missense probably benign 0.00
R1218:Tbx5 UTSW 5 119,976,785 (GRCm39) missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119,983,178 (GRCm39) splice site probably null
R2011:Tbx5 UTSW 5 119,979,971 (GRCm39) splice site probably null
R2125:Tbx5 UTSW 5 119,974,988 (GRCm39) missense probably benign
R2126:Tbx5 UTSW 5 119,974,988 (GRCm39) missense probably benign
R2268:Tbx5 UTSW 5 119,983,174 (GRCm39) splice site probably null
R2302:Tbx5 UTSW 5 119,979,924 (GRCm39) missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119,979,964 (GRCm39) missense probably damaging 1.00
R4930:Tbx5 UTSW 5 120,021,090 (GRCm39) missense probably benign 0.44
R5062:Tbx5 UTSW 5 119,974,987 (GRCm39) missense probably damaging 0.99
R5245:Tbx5 UTSW 5 120,021,230 (GRCm39) missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6079:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6138:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6218:Tbx5 UTSW 5 119,991,663 (GRCm39) missense probably damaging 1.00
R6528:Tbx5 UTSW 5 120,021,176 (GRCm39) missense probably damaging 0.97
R6700:Tbx5 UTSW 5 120,009,462 (GRCm39) missense probably benign 0.30
R6993:Tbx5 UTSW 5 120,009,454 (GRCm39) missense possibly damaging 0.75
R7801:Tbx5 UTSW 5 119,975,064 (GRCm39) missense probably benign 0.44
R8056:Tbx5 UTSW 5 119,991,678 (GRCm39) missense probably benign
R8772:Tbx5 UTSW 5 119,976,790 (GRCm39) missense probably benign 0.02
R9706:Tbx5 UTSW 5 119,979,909 (GRCm39) missense probably benign 0.42
U15987:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
X0028:Tbx5 UTSW 5 119,983,184 (GRCm39) critical splice donor site probably null
Z1176:Tbx5 UTSW 5 120,021,380 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGACACCTTCTATCGCTCGG -3'
(R):5'- GCCGTGAGTGTAGAGAAACTCTG -3'

Sequencing Primer
(F):5'- TATCGCTCGGGCTACCC -3'
(R):5'- TGTAGAGAAACTCTGGGGGCTG -3'
Posted On 2019-11-26