Incidental Mutation 'R7777:Radil'
ID598949
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene NameRas association and DIL domains
SynonymsD930005D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142484839-142551098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 142543548 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 131 (F131C)
Ref Sequence ENSEMBL: ENSMUSP00000064539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110785] [ENSMUST00000129212]
Predicted Effect probably damaging
Transcript: ENSMUST00000063635
AA Change: F131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: F131C

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085758
AA Change: F160C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: F160C

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110785
AA Change: F131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: F131C

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129212
SMART Domains Protein: ENSMUSP00000115800
Gene: ENSMUSG00000029576

DomainStartEndE-ValueType
Pfam:RA 61 107 5.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142497922 missense probably damaging 0.99
IGL01359:Radil APN 5 142543713 missense probably damaging 0.98
IGL01714:Radil APN 5 142543397 unclassified probably benign
IGL02086:Radil APN 5 142543821 missense probably benign 0.28
IGL02250:Radil APN 5 142543774 missense probably damaging 1.00
IGL02296:Radil APN 5 142506463 missense probably benign 0.10
IGL02890:Radil APN 5 142543708 missense probably damaging 1.00
IGL02978:Radil APN 5 142494919 missense probably benign 0.00
IGL03131:Radil APN 5 142495342 missense probably damaging 1.00
R0362:Radil UTSW 5 142543827 missense probably benign 0.00
R0389:Radil UTSW 5 142543471 missense probably damaging 0.98
R0426:Radil UTSW 5 142497873 missense probably damaging 1.00
R1753:Radil UTSW 5 142495336 missense probably damaging 1.00
R2168:Radil UTSW 5 142506963 missense probably benign 0.00
R3055:Radil UTSW 5 142495406 missense possibly damaging 0.77
R3177:Radil UTSW 5 142506856 missense probably damaging 1.00
R3277:Radil UTSW 5 142506856 missense probably damaging 1.00
R3851:Radil UTSW 5 142506997 missense probably damaging 1.00
R4043:Radil UTSW 5 142494233 missense probably benign 0.31
R4245:Radil UTSW 5 142543791 missense probably damaging 1.00
R4367:Radil UTSW 5 142494805 missense probably benign 0.06
R4697:Radil UTSW 5 142486801 missense probably benign
R4798:Radil UTSW 5 142485163 missense probably benign 0.39
R4948:Radil UTSW 5 142485239 missense probably benign 0.02
R5407:Radil UTSW 5 142508215 missense probably damaging 1.00
R5784:Radil UTSW 5 142487513 missense possibly damaging 0.88
R5918:Radil UTSW 5 142487602 missense probably benign 0.43
R5943:Radil UTSW 5 142485458 missense probably damaging 1.00
R6112:Radil UTSW 5 142543644 missense probably damaging 1.00
R6147:Radil UTSW 5 142497940 missense probably benign 0.01
R6174:Radil UTSW 5 142487115 missense probably benign
R6241:Radil UTSW 5 142494942 missense probably damaging 1.00
R6874:Radil UTSW 5 142506802 missense probably damaging 1.00
R6881:Radil UTSW 5 142486917 missense probably benign 0.00
R7056:Radil UTSW 5 142494354 nonsense probably null
R7134:Radil UTSW 5 142485549 missense probably damaging 1.00
R7167:Radil UTSW 5 142485505 splice site probably null
R7374:Radil UTSW 5 142485480 missense probably damaging 1.00
R7482:Radil UTSW 5 142486763 missense probably benign
R7607:Radil UTSW 5 142494795 missense probably damaging 0.98
R7607:Radil UTSW 5 142506613 missense probably damaging 0.99
R7779:Radil UTSW 5 142487565 missense probably benign 0.03
R8047:Radil UTSW 5 142494940 missense probably damaging 1.00
R8123:Radil UTSW 5 142487620 missense probably damaging 0.99
R8418:Radil UTSW 5 142494921 missense probably benign 0.23
R8525:Radil UTSW 5 142488501 missense probably damaging 1.00
R8708:Radil UTSW 5 142485449 missense probably damaging 1.00
R8827:Radil UTSW 5 142508104 missense probably damaging 1.00
X0058:Radil UTSW 5 142487514 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTCTGAGCATGACAGTGACTC -3'
(R):5'- TGTACAGGCACCCACTATAAGAG -3'

Sequencing Primer
(F):5'- AGCCCCACTGGTTCCCAC -3'
(R):5'- ACTATAAGAGTGTCTTGGCCACTG -3'
Posted On2019-11-26