Incidental Mutation 'R7777:Fam3c'
ID598950
Institutional Source Beutler Lab
Gene Symbol Fam3c
Ensembl Gene ENSMUSG00000029672
Gene Namefamily with sequence similarity 3, member C
SynonymsFam3c, D6Wsu176e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location22306520-22356243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22328574 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 105 (I105V)
Ref Sequence ENSEMBL: ENSMUSP00000127559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081288] [ENSMUST00000163371] [ENSMUST00000163963] [ENSMUST00000165576] [ENSMUST00000168965]
Predicted Effect probably benign
Transcript: ENSMUST00000081288
AA Change: I55V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080040
Gene: ENSMUSG00000029672
AA Change: I55V

DomainStartEndE-ValueType
PDB:2YOP|C 18 194 9e-45 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000163371
AA Change: I85V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128855
Gene: ENSMUSG00000029672
AA Change: I85V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163963
AA Change: I105V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127559
Gene: ENSMUSG00000029672
AA Change: I105V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:ILEI 122 214 1.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165576
AA Change: I85V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127709
Gene: ENSMUSG00000029672
AA Change: I85V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 224 4e-44 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168965
AA Change: I85V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128135
Gene: ENSMUSG00000029672
AA Change: I85V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 110 6e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out or gene trap allele exhibit normal skeletal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Fam3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Fam3c APN 6 22318948 missense probably damaging 1.00
IGL01958:Fam3c APN 6 22318955 missense probably damaging 1.00
IGL02017:Fam3c APN 6 22343277 start codon destroyed probably null 0.66
PIT4812001:Fam3c UTSW 6 22321370 missense probably damaging 1.00
R1829:Fam3c UTSW 6 22309437 missense probably damaging 1.00
R2024:Fam3c UTSW 6 22329593 missense probably benign 0.33
R2884:Fam3c UTSW 6 22329582 missense probably damaging 0.98
R5481:Fam3c UTSW 6 22321358 missense probably benign 0.30
R5662:Fam3c UTSW 6 22355062 intron probably benign
R5911:Fam3c UTSW 6 22328561 missense probably damaging 1.00
R5911:Fam3c UTSW 6 22339300 missense probably benign 0.00
R6575:Fam3c UTSW 6 22329608 missense probably damaging 1.00
R6687:Fam3c UTSW 6 22328670 missense probably benign 0.03
R6982:Fam3c UTSW 6 22322301 missense probably damaging 1.00
R7570:Fam3c UTSW 6 22326405 intron probably benign
R7994:Fam3c UTSW 6 22308460 missense probably damaging 0.98
R8082:Fam3c UTSW 6 22343304 missense unknown
R8254:Fam3c UTSW 6 22328676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGCAGGTCTCTTTGTCACAG -3'
(R):5'- ATTAAAGAATGTGTGTCTCGCC -3'

Sequencing Primer
(F):5'- CAGGTCTCTTTGTCACAGGGGAG -3'
(R):5'- ATGGATGTATGCTCACCACG -3'
Posted On2019-11-26