Incidental Mutation 'R7777:Vmn2r44'
ID598954
Institutional Source Beutler Lab
Gene Symbol Vmn2r44
Ensembl Gene ENSMUSG00000094098
Gene Namevomeronasal 2, receptor 44
SynonymsEG434113
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7777 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location8366502-8383354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8378315 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 193 (T193K)
Ref Sequence ENSEMBL: ENSMUSP00000132467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166499
AA Change: T193K

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132467
Gene: ENSMUSG00000094098
AA Change: T193K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-34 PFAM
Pfam:NCD3G 512 565 3.8e-20 PFAM
Pfam:7tm_3 598 833 5.7e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Vmn2r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Vmn2r44 APN 7 8380104 critical splice donor site probably null
IGL01723:Vmn2r44 APN 7 8377916 missense probably damaging 0.97
IGL01767:Vmn2r44 APN 7 8380238 missense probably benign 0.00
IGL02161:Vmn2r44 APN 7 8377815 missense possibly damaging 0.94
IGL02299:Vmn2r44 APN 7 8377816 missense probably benign
IGL02418:Vmn2r44 APN 7 8377865 missense probably damaging 1.00
IGL02829:Vmn2r44 APN 7 8377880 missense possibly damaging 0.94
IGL02851:Vmn2r44 APN 7 8383051 missense probably damaging 1.00
IGL03080:Vmn2r44 APN 7 8383245 utr 5 prime probably benign
R1471:Vmn2r44 UTSW 7 8377883 missense probably damaging 0.99
R1789:Vmn2r44 UTSW 7 8380123 missense possibly damaging 0.64
R1932:Vmn2r44 UTSW 7 8367982 missense probably benign 0.04
R2354:Vmn2r44 UTSW 7 8370640 missense probably damaging 0.99
R4009:Vmn2r44 UTSW 7 8377988 missense possibly damaging 0.82
R4130:Vmn2r44 UTSW 7 8367919 missense probably damaging 1.00
R4790:Vmn2r44 UTSW 7 8367950 missense probably damaging 1.00
R4854:Vmn2r44 UTSW 7 8380301 missense possibly damaging 0.94
R4887:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R4888:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R5484:Vmn2r44 UTSW 7 8380124 missense possibly damaging 0.69
R6110:Vmn2r44 UTSW 7 8378006 missense probably damaging 1.00
R6357:Vmn2r44 UTSW 7 8370658 missense probably benign 0.01
R6526:Vmn2r44 UTSW 7 8378099 missense probably benign 0.01
R7083:Vmn2r44 UTSW 7 8378370 missense probably benign 0.44
R7087:Vmn2r44 UTSW 7 8378367 missense probably benign 0.02
R7115:Vmn2r44 UTSW 7 8367528 nonsense probably null
R7125:Vmn2r44 UTSW 7 8367942 missense probably damaging 1.00
R7258:Vmn2r44 UTSW 7 8377849 missense probably damaging 1.00
R7359:Vmn2r44 UTSW 7 8367539 missense probably benign 0.30
R7494:Vmn2r44 UTSW 7 8383123 nonsense probably null
R7766:Vmn2r44 UTSW 7 8368220 missense probably damaging 1.00
R8184:Vmn2r44 UTSW 7 8368228 nonsense probably null
R8674:Vmn2r44 UTSW 7 8377823 missense probably damaging 1.00
R8752:Vmn2r44 UTSW 7 8367806 missense probably damaging 1.00
R8897:Vmn2r44 UTSW 7 8378243 missense probably damaging 1.00
R8915:Vmn2r44 UTSW 7 8367651 missense probably damaging 1.00
Z1177:Vmn2r44 UTSW 7 8367977 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTCCCACATTCTGAAGATC -3'
(R):5'- CACAGGTAATCAACAGTTTGCAGG -3'

Sequencing Primer
(F):5'- GGTTCCCACATTCTGAAGATCAAATC -3'
(R):5'- TCAACAGTTTGCAGGTAAGTATG -3'
Posted On2019-11-26