Incidental Mutation 'R7777:Or13a25'
ID 598957
Institutional Source Beutler Lab
Gene Symbol Or13a25
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor family 13 subfamily A member 25
Synonyms GA_x6K02T2PBJ9-42813436-42814368, Olfr539, MOR253-4
MMRRC Submission 045833-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7777 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247202-140248161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140247854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 211 (I211N)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably benign
Transcript: ENSMUST00000078967
AA Change: I218N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: I218N

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: I211N
Predicted Effect probably benign
Transcript: ENSMUST00000218865
AA Change: I211N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,758 (GRCm39) P192S possibly damaging Het
Arhgef10 A G 8: 14,995,373 (GRCm39) T353A probably damaging Het
Cabyr A G 18: 12,877,828 (GRCm39) D55G probably damaging Het
Dcaf4 T C 12: 83,584,733 (GRCm39) V322A probably damaging Het
Ephb2 T A 4: 136,498,947 (GRCm39) E44V possibly damaging Het
Fam3c T C 6: 22,328,573 (GRCm39) I105V probably benign Het
Fras1 A G 5: 96,900,763 (GRCm39) D2994G probably damaging Het
Fryl C T 5: 73,228,641 (GRCm39) D1697N probably damaging Het
Gapdh A T 6: 125,139,911 (GRCm39) Y164* probably null Het
Gm4353 T G 7: 115,682,998 (GRCm39) Q194H possibly damaging Het
Ilvbl T A 10: 78,413,085 (GRCm39) probably null Het
Ism2 T A 12: 87,333,658 (GRCm39) probably null Het
Jak2 C T 19: 29,254,268 (GRCm39) T196I probably benign Het
Lcor T G 19: 41,547,234 (GRCm39) Y273D probably benign Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lysmd4 T A 7: 66,873,446 (GRCm39) M27K possibly damaging Het
Muc17 G A 5: 137,175,564 (GRCm39) silent Het
Or11h4b A T 14: 50,918,261 (GRCm39) Y277N probably damaging Het
Or5m10 A G 2: 85,717,951 (GRCm39) E269G possibly damaging Het
Oscp1 T C 4: 125,958,774 (GRCm39) probably null Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd2l2 C A 18: 34,549,913 (GRCm39) P186Q probably damaging Het
Plcb1 G A 2: 135,062,677 (GRCm39) G96R possibly damaging Het
Plcd3 G C 11: 102,965,481 (GRCm39) R535G probably benign Het
Plcg1 A G 2: 160,596,523 (GRCm39) M681V possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Polrmt A T 10: 79,575,022 (GRCm39) D836E probably benign Het
Pramel12 T C 4: 143,144,331 (GRCm39) Y226H possibly damaging Het
Prkag1 A T 15: 98,712,478 (GRCm39) I149N probably damaging Het
Prkci A T 3: 31,104,362 (GRCm39) Q575L possibly damaging Het
Prss40 C T 1: 34,591,846 (GRCm39) W276* probably null Het
Ptprn T C 1: 75,228,946 (GRCm39) D823G possibly damaging Het
Radil A C 5: 142,529,303 (GRCm39) F131C probably damaging Het
Rif1 A G 2: 52,006,368 (GRCm39) I550V probably benign Het
Rmnd1 T C 10: 4,361,713 (GRCm39) E320G probably damaging Het
Sec31b T A 19: 44,512,212 (GRCm39) K561* probably null Het
Spata31g1 C T 4: 42,970,171 (GRCm39) Q53* probably null Het
Spata31g1 T C 4: 42,971,095 (GRCm39) S143P probably benign Het
Tbx5 A C 5: 120,021,232 (GRCm39) T413P probably benign Het
Tmprss7 A G 16: 45,480,963 (GRCm39) probably null Het
Tnfaip8l2 T C 3: 95,047,307 (GRCm39) *185W probably null Het
Tpst2 A G 5: 112,457,560 (GRCm39) E296G possibly damaging Het
Ubn2 T A 6: 38,467,688 (GRCm39) S801T probably damaging Het
Usp34 A G 11: 23,332,638 (GRCm39) S1141G Het
Uts2r A G 11: 121,052,279 (GRCm39) N381S probably benign Het
Vmn2r44 G T 7: 8,381,314 (GRCm39) T193K possibly damaging Het
Wdr18 T A 10: 79,801,884 (GRCm39) M223K probably benign Het
Wdr64 T C 1: 175,617,564 (GRCm39) C715R possibly damaging Het
Zfp672 A G 11: 58,208,081 (GRCm39) F80S possibly damaging Het
Other mutations in Or13a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Or13a25 APN 7 140,247,854 (GRCm39) missense probably benign 0.01
IGL01610:Or13a25 APN 7 140,247,584 (GRCm39) missense probably damaging 1.00
IGL02959:Or13a25 APN 7 140,247,463 (GRCm39) missense probably damaging 1.00
IGL03406:Or13a25 APN 7 140,247,424 (GRCm39) missense probably damaging 1.00
R0671:Or13a25 UTSW 7 140,247,590 (GRCm39) missense probably damaging 1.00
R1771:Or13a25 UTSW 7 140,248,048 (GRCm39) missense probably benign
R1934:Or13a25 UTSW 7 140,247,951 (GRCm39) nonsense probably null
R1985:Or13a25 UTSW 7 140,247,734 (GRCm39) missense probably damaging 1.00
R2962:Or13a25 UTSW 7 140,247,862 (GRCm39) missense probably benign
R4239:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4240:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4360:Or13a25 UTSW 7 140,247,730 (GRCm39) missense probably damaging 0.98
R4841:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4842:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4851:Or13a25 UTSW 7 140,247,226 (GRCm39) missense probably benign
R5325:Or13a25 UTSW 7 140,247,705 (GRCm39) missense probably benign 0.33
R5766:Or13a25 UTSW 7 140,247,266 (GRCm39) missense probably benign 0.02
R6363:Or13a25 UTSW 7 140,247,995 (GRCm39) missense possibly damaging 0.93
R6836:Or13a25 UTSW 7 140,248,093 (GRCm39) missense possibly damaging 0.86
R7920:Or13a25 UTSW 7 140,247,814 (GRCm39) missense possibly damaging 0.92
R8134:Or13a25 UTSW 7 140,247,680 (GRCm39) missense possibly damaging 0.90
R8712:Or13a25 UTSW 7 140,248,052 (GRCm39) missense possibly damaging 0.89
R9095:Or13a25 UTSW 7 140,247,813 (GRCm39) missense probably damaging 1.00
R9158:Or13a25 UTSW 7 140,247,547 (GRCm39) missense possibly damaging 0.76
R9603:Or13a25 UTSW 7 140,247,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAATGCATGTGTCCACAC -3'
(R):5'- GCAAGCTTGACATCCTTGTTC -3'

Sequencing Primer
(F):5'- ACACTGGTCTAATGACACGCTTG -3'
(R):5'- TGAGTACAGAACTGAGGTAACTTTGC -3'
Posted On 2019-11-26