Incidental Mutation 'R7777:Olfr539'
ID598957
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Nameolfactory receptor 539
SynonymsMOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140659930-140678580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140667941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 211 (I211N)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
Predicted Effect probably benign
Transcript: ENSMUST00000078967
AA Change: I218N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: I218N

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: I211N
Predicted Effect probably benign
Transcript: ENSMUST00000218865
AA Change: I211N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTGAATGCATGTGTCCACAC -3'
(R):5'- GCAAGCTTGACATCCTTGTTC -3'

Sequencing Primer
(F):5'- ACACTGGTCTAATGACACGCTTG -3'
(R):5'- TGAGTACAGAACTGAGGTAACTTTGC -3'
Posted On2019-11-26