Incidental Mutation 'R7777:Rmnd1'
ID598959
Institutional Source Beutler Lab
Gene Symbol Rmnd1
Ensembl Gene ENSMUSG00000019763
Gene Namerequired for meiotic nuclear division 1 homolog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location4401915-4432388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4411713 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 320 (E320G)
Ref Sequence ENSEMBL: ENSMUSP00000043355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042251] [ENSMUST00000128434]
Predicted Effect probably damaging
Transcript: ENSMUST00000042251
AA Change: E320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043355
Gene: ENSMUSG00000019763
AA Change: E320G

DomainStartEndE-ValueType
Pfam:DUF155 227 404 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128434
SMART Domains Protein: ENSMUSP00000119195
Gene: ENSMUSG00000019763

DomainStartEndE-ValueType
Pfam:DUF155 1 42 8.4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved sif2 family of proteins that share the DUF155 domain in common. This protein is thought to be localized in the mitochondria and involved in mitochondrial translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-11. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Rmnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Rmnd1 APN 10 4427392 missense probably benign
IGL01018:Rmnd1 APN 10 4427290 missense probably benign 0.43
IGL01112:Rmnd1 APN 10 4410793 splice site probably null
R0418:Rmnd1 UTSW 10 4427693 critical splice acceptor site probably null
R2036:Rmnd1 UTSW 10 4407884 missense probably damaging 1.00
R2312:Rmnd1 UTSW 10 4427466 missense probably benign
R2319:Rmnd1 UTSW 10 4422099 missense possibly damaging 0.62
R4191:Rmnd1 UTSW 10 4410809 unclassified probably benign
R5077:Rmnd1 UTSW 10 4427488 missense possibly damaging 0.66
R5620:Rmnd1 UTSW 10 4422159 missense probably damaging 1.00
R5659:Rmnd1 UTSW 10 4427382 missense probably benign 0.04
R6291:Rmnd1 UTSW 10 4422135 missense probably damaging 1.00
R7089:Rmnd1 UTSW 10 4403873 missense probably damaging 1.00
R7214:Rmnd1 UTSW 10 4410753 missense probably benign
R7260:Rmnd1 UTSW 10 4414803 splice site probably null
R7540:Rmnd1 UTSW 10 4403989 missense probably damaging 1.00
R7599:Rmnd1 UTSW 10 4413404 missense probably benign 0.11
R7719:Rmnd1 UTSW 10 4427496 missense probably benign
R7809:Rmnd1 UTSW 10 4407848 missense probably damaging 1.00
R8397:Rmnd1 UTSW 10 4427278 nonsense probably null
X0026:Rmnd1 UTSW 10 4427676 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- TCCTGGTCGTTAGCTCATCG -3'
(R):5'- CTTCGTGTCTGAGCCATACTTAG -3'

Sequencing Primer
(F):5'- CTCATCGCTTCGTGTGTAACTGAAAG -3'
(R):5'- TCTGAGCCATACTTAGAGGGC -3'
Posted On2019-11-26