Incidental Mutation 'R7777:Wdr18'
ID598962
Institutional Source Beutler Lab
Gene Symbol Wdr18
Ensembl Gene ENSMUSG00000035754
Gene NameWD repeat domain 18
Synonyms2310012I10Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175450.4; MGI: 2158400

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79960152-79970203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79966050 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 223 (M223K)
Ref Sequence ENSEMBL: ENSMUSP00000041049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000045247]
Predicted Effect probably benign
Transcript: ENSMUST00000045085
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045247
AA Change: M223K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754
AA Change: M223K

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(8) : Targeted(1) Gene trapped(7)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Wdr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Wdr18 APN 10 79965272 missense probably damaging 1.00
IGL02812:Wdr18 APN 10 79961064 missense possibly damaging 0.68
IGL02949:Wdr18 APN 10 79965055 missense probably benign 0.00
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0244:Wdr18 UTSW 10 79966408 missense probably damaging 1.00
R0257:Wdr18 UTSW 10 79961119 splice site probably benign
R0377:Wdr18 UTSW 10 79967502 missense probably benign 0.40
R1844:Wdr18 UTSW 10 79966727 critical splice donor site probably null
R4179:Wdr18 UTSW 10 79965041 missense probably damaging 1.00
R4674:Wdr18 UTSW 10 79965235 missense probably benign
R5573:Wdr18 UTSW 10 79965038 missense probably benign
R6007:Wdr18 UTSW 10 79965343 missense possibly damaging 0.94
R6455:Wdr18 UTSW 10 79965281 missense probably damaging 1.00
R7042:Wdr18 UTSW 10 79966110 missense probably benign 0.22
R7223:Wdr18 UTSW 10 79960368 missense probably damaging 1.00
R7316:Wdr18 UTSW 10 79965225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGTAGCATGGGCATGATG -3'
(R):5'- TGACTACCTGTGTCCTTTGAAGAC -3'

Sequencing Primer
(F):5'- ATGATGGTGCGATGGCCC -3'
(R):5'- TTCTGCTCAGGCTGGAAGC -3'
Posted On2019-11-26