Incidental Mutation 'R7777:Usp34'
ID 598963
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 045833-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R7777 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23332638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1141 (S1141G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: S1141G

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: S1122G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: S1122G

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,758 (GRCm39) P192S possibly damaging Het
Arhgef10 A G 8: 14,995,373 (GRCm39) T353A probably damaging Het
Cabyr A G 18: 12,877,828 (GRCm39) D55G probably damaging Het
Dcaf4 T C 12: 83,584,733 (GRCm39) V322A probably damaging Het
Ephb2 T A 4: 136,498,947 (GRCm39) E44V possibly damaging Het
Fam3c T C 6: 22,328,573 (GRCm39) I105V probably benign Het
Fras1 A G 5: 96,900,763 (GRCm39) D2994G probably damaging Het
Fryl C T 5: 73,228,641 (GRCm39) D1697N probably damaging Het
Gapdh A T 6: 125,139,911 (GRCm39) Y164* probably null Het
Gm4353 T G 7: 115,682,998 (GRCm39) Q194H possibly damaging Het
Ilvbl T A 10: 78,413,085 (GRCm39) probably null Het
Ism2 T A 12: 87,333,658 (GRCm39) probably null Het
Jak2 C T 19: 29,254,268 (GRCm39) T196I probably benign Het
Lcor T G 19: 41,547,234 (GRCm39) Y273D probably benign Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lysmd4 T A 7: 66,873,446 (GRCm39) M27K possibly damaging Het
Muc17 G A 5: 137,175,564 (GRCm39) silent Het
Or11h4b A T 14: 50,918,261 (GRCm39) Y277N probably damaging Het
Or13a25 T A 7: 140,247,854 (GRCm39) I211N probably benign Het
Or5m10 A G 2: 85,717,951 (GRCm39) E269G possibly damaging Het
Oscp1 T C 4: 125,958,774 (GRCm39) probably null Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd2l2 C A 18: 34,549,913 (GRCm39) P186Q probably damaging Het
Plcb1 G A 2: 135,062,677 (GRCm39) G96R possibly damaging Het
Plcd3 G C 11: 102,965,481 (GRCm39) R535G probably benign Het
Plcg1 A G 2: 160,596,523 (GRCm39) M681V possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Polrmt A T 10: 79,575,022 (GRCm39) D836E probably benign Het
Pramel12 T C 4: 143,144,331 (GRCm39) Y226H possibly damaging Het
Prkag1 A T 15: 98,712,478 (GRCm39) I149N probably damaging Het
Prkci A T 3: 31,104,362 (GRCm39) Q575L possibly damaging Het
Prss40 C T 1: 34,591,846 (GRCm39) W276* probably null Het
Ptprn T C 1: 75,228,946 (GRCm39) D823G possibly damaging Het
Radil A C 5: 142,529,303 (GRCm39) F131C probably damaging Het
Rif1 A G 2: 52,006,368 (GRCm39) I550V probably benign Het
Rmnd1 T C 10: 4,361,713 (GRCm39) E320G probably damaging Het
Sec31b T A 19: 44,512,212 (GRCm39) K561* probably null Het
Spata31g1 C T 4: 42,970,171 (GRCm39) Q53* probably null Het
Spata31g1 T C 4: 42,971,095 (GRCm39) S143P probably benign Het
Tbx5 A C 5: 120,021,232 (GRCm39) T413P probably benign Het
Tmprss7 A G 16: 45,480,963 (GRCm39) probably null Het
Tnfaip8l2 T C 3: 95,047,307 (GRCm39) *185W probably null Het
Tpst2 A G 5: 112,457,560 (GRCm39) E296G possibly damaging Het
Ubn2 T A 6: 38,467,688 (GRCm39) S801T probably damaging Het
Uts2r A G 11: 121,052,279 (GRCm39) N381S probably benign Het
Vmn2r44 G T 7: 8,381,314 (GRCm39) T193K possibly damaging Het
Wdr18 T A 10: 79,801,884 (GRCm39) M223K probably benign Het
Wdr64 T C 1: 175,617,564 (GRCm39) C715R possibly damaging Het
Zfp672 A G 11: 58,208,081 (GRCm39) F80S possibly damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAAATTCTAATTCTGCGTTCTC -3'
(R):5'- AGGCTTTCTTGTGCAAAACC -3'

Sequencing Primer
(F):5'- CTTAAGATGCCCCAGCTT -3'
(R):5'- GTGCAAAACCACAGTTCTCTTTGG -3'
Posted On 2019-11-26