Incidental Mutation 'R7777:Dcaf4'
ID598967
Institutional Source Beutler Lab
Gene Symbol Dcaf4
Ensembl Gene ENSMUSG00000021222
Gene NameDDB1 and CUL4 associated factor 4
Synonyms1110018E21Rik, Wdr21
Accession Numbers

Genbank: NM_030246; MGI: 1921078

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7777 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location83520466-83541920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83537959 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 322 (V322A)
Ref Sequence ENSEMBL: ENSMUSP00000152717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021645] [ENSMUST00000223291]
Predicted Effect probably damaging
Transcript: ENSMUST00000021645
AA Change: V309A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222
AA Change: V309A

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000223291
AA Change: V322A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(39) : Gene trapped(39)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y not run Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Dcaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Dcaf4 APN 12 83539333 missense probably damaging 1.00
IGL01401:Dcaf4 APN 12 83541374 missense probably damaging 1.00
IGL02393:Dcaf4 APN 12 83530031 missense probably damaging 1.00
IGL02970:Dcaf4 APN 12 83529215 missense probably damaging 0.99
F5770:Dcaf4 UTSW 12 83537701 splice site probably null
PIT4504001:Dcaf4 UTSW 12 83534011 critical splice donor site probably null
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0164:Dcaf4 UTSW 12 83535988 splice site probably benign
R0165:Dcaf4 UTSW 12 83535988 splice site probably benign
R0167:Dcaf4 UTSW 12 83535988 splice site probably benign
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0594:Dcaf4 UTSW 12 83538043 critical splice donor site probably null
R1191:Dcaf4 UTSW 12 83535967 missense probably damaging 1.00
R4499:Dcaf4 UTSW 12 83539360 missense probably damaging 1.00
R4896:Dcaf4 UTSW 12 83539459 missense possibly damaging 0.86
R4932:Dcaf4 UTSW 12 83532304 missense possibly damaging 0.61
R5882:Dcaf4 UTSW 12 83539429 missense probably damaging 0.96
R7084:Dcaf4 UTSW 12 83537797 frame shift probably null
R7564:Dcaf4 UTSW 12 83541523 missense probably damaging 0.97
V7583:Dcaf4 UTSW 12 83537701 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGTAGTTTCCGGATCCCTG -3'
(R):5'- TTTCCTTGTAAGAGGCACCAGC -3'

Sequencing Primer
(F):5'- TGGTCCTTGAACGTCCAGG -3'
(R):5'- CAGCCCAGAGTTACAGCAGG -3'
Posted On2019-11-26