Incidental Mutation 'R7777:Pkd2l2'
ID598972
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Namepolycystic kidney disease 2-like 2
SynonymsTRPP5, Polycystin - L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7777 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34409423-34442789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34416860 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 186 (P186Q)
Ref Sequence ENSEMBL: ENSMUSP00000014647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000166156]
Predicted Effect probably damaging
Transcript: ENSMUST00000014647
AA Change: P186Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: P186Q

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166156
AA Change: P186Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: P186Q

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Lcor T G 19: 41,558,795 Y273D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34417015 missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34417036 missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34435368 critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34412715 nonsense probably null
IGL02480:Pkd2l2 APN 18 34438790 missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34416917 nonsense probably null
IGL02818:Pkd2l2 APN 18 34412809 missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34430320 missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34425089 missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34435327 missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34425102 missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34430268 splice site probably null
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0974:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34438216 critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34430702 missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34427393 missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34430329 missense probably damaging 1.00
R3695:Pkd2l2 UTSW 18 34438790 missense possibly damaging 0.48
R4058:Pkd2l2 UTSW 18 34428192 missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34438201 missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34409836 nonsense probably null
R4652:Pkd2l2 UTSW 18 34409836 nonsense probably null
R5114:Pkd2l2 UTSW 18 34433302 missense probably benign
R5341:Pkd2l2 UTSW 18 34409934 splice site probably null
R5686:Pkd2l2 UTSW 18 34425237 missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34430773 missense probably benign
R6061:Pkd2l2 UTSW 18 34430689 missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34428244 missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34414680 missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34427444 missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34438771 missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34425081 missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34438157 missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34416883 missense probably benign 0.02
R6958:Pkd2l2 UTSW 18 34409490 nonsense probably null
R7052:Pkd2l2 UTSW 18 34425159 missense possibly damaging 0.90
R7695:Pkd2l2 UTSW 18 34428245 missense possibly damaging 0.77
R7763:Pkd2l2 UTSW 18 34433287 critical splice acceptor site probably null
R7944:Pkd2l2 UTSW 18 34427428 missense possibly damaging 0.90
R8003:Pkd2l2 UTSW 18 34428179 missense probably damaging 1.00
R8468:Pkd2l2 UTSW 18 34427411 missense possibly damaging 0.88
R8482:Pkd2l2 UTSW 18 34425113 missense possibly damaging 0.52
R8729:Pkd2l2 UTSW 18 34433301 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAACCTGCTGAGTGTTGGCC -3'
(R):5'- TTTCCTAAGATAAGGCTCCCGAG -3'

Sequencing Primer
(F):5'- GTGTTGGCCCTTGTAACAAATTAAC -3'
(R):5'- CTCACCTGATGATGCAAAACAGGTTG -3'
Posted On2019-11-26