Incidental Mutation 'R7777:Lcor'
ID 598975
Institutional Source Beutler Lab
Gene Symbol Lcor
Ensembl Gene ENSMUSG00000025019
Gene Name ligand dependent nuclear receptor corepressor
Synonyms A630025C20Rik, Mlr2, 3110023F06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock # R7777 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 41482645-41562246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 41558795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 273 (Y273D)
Ref Sequence ENSEMBL: ENSMUSP00000067603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]
AlphaFold Q6ZPI3
Predicted Effect probably benign
Transcript: ENSMUST00000067795
AA Change: Y273D

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019
AA Change: Y273D

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163929
AA Change: Y273D

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019
AA Change: Y273D

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 5.1e-18 PFAM
Meta Mutation Damage Score 0.1307 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,970,171 Q53* probably null Het
1700022I11Rik T C 4: 42,971,095 S143P probably benign Het
Adam6b C T 12: 113,490,138 P192S possibly damaging Het
Arhgef10 A G 8: 14,945,373 T353A probably damaging Het
Cabyr A G 18: 12,744,771 D55G probably damaging Het
Dcaf4 T C 12: 83,537,959 V322A probably damaging Het
Ephb2 T A 4: 136,771,636 E44V possibly damaging Het
Fam3c T C 6: 22,328,574 I105V probably benign Het
Fras1 A G 5: 96,752,904 D2994G probably damaging Het
Fryl C T 5: 73,071,298 D1697N probably damaging Het
Gapdh A T 6: 125,162,948 Y164* probably null Het
Gm4353 T G 7: 116,083,763 Q194H possibly damaging Het
Ilvbl T A 10: 78,577,251 probably null Het
Ism2 T A 12: 87,286,884 probably null Het
Jak2 C T 19: 29,276,868 T196I probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lysmd4 T A 7: 67,223,698 M27K possibly damaging Het
Muc3 G A 5: 137,146,716 silent Het
Olfr1023 A G 2: 85,887,607 E269G possibly damaging Het
Olfr539 T A 7: 140,667,941 I211N probably benign Het
Olfr747 A T 14: 50,680,804 Y277N probably damaging Het
Oscp1 T C 4: 126,064,981 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Pkd2l2 C A 18: 34,416,860 P186Q probably damaging Het
Plcb1 G A 2: 135,220,757 G96R possibly damaging Het
Plcd3 G C 11: 103,074,655 R535G probably benign Het
Plcg1 A G 2: 160,754,603 M681V possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Polrmt A T 10: 79,739,188 D836E probably benign Het
Pramef8 T C 4: 143,417,761 Y226H possibly damaging Het
Prkag1 A T 15: 98,814,597 I149N probably damaging Het
Prkci A T 3: 31,050,213 Q575L possibly damaging Het
Prss40 C T 1: 34,552,765 W276* probably null Het
Ptprn T C 1: 75,252,302 D823G possibly damaging Het
Radil A C 5: 142,543,548 F131C probably damaging Het
Rif1 A G 2: 52,116,356 I550V probably benign Het
Rmnd1 T C 10: 4,411,713 E320G probably damaging Het
Sec31b T A 19: 44,523,773 K561* probably null Het
Tbx5 A C 5: 119,883,167 T413P probably benign Het
Tmprss7 A G 16: 45,660,600 probably null Het
Tnfaip8l2 T C 3: 95,139,996 *185W probably null Het
Tpst2 A G 5: 112,309,694 E296G possibly damaging Het
Ubn2 T A 6: 38,490,753 S801T probably damaging Het
Usp34 A G 11: 23,382,638 S1141G Het
Uts2r A G 11: 121,161,453 N381S probably benign Het
Vmn2r44 G T 7: 8,378,315 T193K possibly damaging Het
Wdr18 T A 10: 79,966,050 M223K probably benign Het
Wdr64 T C 1: 175,789,998 C715R possibly damaging Het
Zfp672 A G 11: 58,317,255 F80S possibly damaging Het
Other mutations in Lcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lcor APN 19 41552700 missense probably damaging 0.97
IGL02079:Lcor APN 19 41555687 missense probably benign 0.40
IGL02100:Lcor APN 19 41558754 missense possibly damaging 0.93
IGL02444:Lcor APN 19 41559011 missense probably damaging 0.99
IGL02578:Lcor APN 19 41559150 missense probably damaging 1.00
IGL03072:Lcor APN 19 41558814 missense possibly damaging 0.85
IGL03118:Lcor APN 19 41558369 missense probably damaging 0.99
IGL03153:Lcor APN 19 41558356 missense probably damaging 0.98
R1756:Lcor UTSW 19 41559266 missense probably benign
R1889:Lcor UTSW 19 41559128 missense probably damaging 0.99
R1913:Lcor UTSW 19 41558474 missense probably benign 0.40
R1983:Lcor UTSW 19 41558367 missense probably damaging 0.98
R3885:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3886:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3888:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3889:Lcor UTSW 19 41558356 missense probably damaging 0.98
R5160:Lcor UTSW 19 41555614 missense probably damaging 0.99
R6112:Lcor UTSW 19 41559081 missense possibly damaging 0.92
R8556:Lcor UTSW 19 41558424 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTATGAATTCAGCCTCAGCCG -3'
(R):5'- GGGTCTCCTTCTTGATCCGATG -3'

Sequencing Primer
(F):5'- CCTCAGCCGAATGAAGTTCAGG -3'
(R):5'- CCGATGTGGGATATGGCTGTCC -3'
Posted On 2019-11-26