Mutagenetix > Incidental Mutation

Incidental Mutation 'R7778:Atp6v0a2'

598991

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R7778 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124641505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 186 (E186G)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: E186G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: E186G

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Meta Mutation Damage Score

0.3041

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,739,511	S524P	possibly damaging	Het
Aplf	A	C	6: 87,658,202		probably null	Het
Asb5	A	C	8: 54,584,792	H173P		Het
Bbs2	A	T	8: 94,089,760		probably null	Het
Chrm5	A	G	2: 112,479,956	S272P	probably benign	Het
Chrna6	T	C	8: 27,407,364	I162V	probably damaging	Het
Cldn6	T	A	17: 23,681,607	C182S	probably damaging	Het
Cysltr2	A	G	14: 73,029,763	I169T	probably benign	Het
Ddx11	T	C	17: 66,130,548		probably null	Het
Efhc1	A	T	1: 20,979,461	Y515F	probably damaging	Het
Elmo1	A	G	13: 20,589,642		probably null	Het
Ep300	T	C	15: 81,586,686	S20P	unknown	Het
Gfpt2	T	G	11: 49,824,441	I421R	probably damaging	Het
Gm14226	T	A	2: 155,024,710	C196S	possibly damaging	Het
Grm8	T	C	6: 27,363,672	R615G	possibly damaging	Het
Hic1	C	T	11: 75,166,216	V616M	possibly damaging	Het
Ing1	A	G	8: 11,561,814	E178G	probably benign	Het
Kansl3	A	T	1: 36,348,677	L530H	probably damaging	Het
Kcna5	A	T	6: 126,534,805	L120*	probably null	Het
Kcnt1	T	G	2: 25,901,889	I617S	probably benign	Het
Lama1	T	A	17: 67,804,473	S2240T		Het
Lcn2	T	C	2: 32,387,915	D55G	probably benign	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Matn2	A	T	15: 34,399,077	H370L	possibly damaging	Het
Mettl23	T	G	11: 116,849,270	V189G	probably benign	Het
Mpp4	G	A	1: 59,123,513	T543M	not run	Het
Odf4	A	T	11: 68,922,072	S253R	probably benign	Het
Olfr39	A	G	9: 20,282,412		probably benign	Het
Olfr748	G	T	14: 50,710,471	C47F	possibly damaging	Het
Olfr883	T	A	9: 38,026,667	I287N	probably damaging	Het
Olfr935	T	A	9: 38,994,907	H176L	probably damaging	Het
Olfr963	C	A	9: 39,669,238	F60L	possibly damaging	Het
Pcdha11	A	T	18: 37,012,680	Y608F	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,525	D342G	probably damaging	Het
Pde6d	A	G	1: 86,543,528	S143P	probably damaging	Het
Plec	A	T	15: 76,176,935	I2934N	probably damaging	Het
Primpol	G	T	8: 46,586,424	P387Q	probably damaging	Het
Prkcd	C	T	14: 30,605,815		probably null	Het
Prph2	T	C	17: 46,910,806	L37S	possibly damaging	Het
Prrt4	A	G	6: 29,177,719	L17P	probably damaging	Het
Pycrl	T	C	15: 75,918,289	D171G	probably damaging	Het
Rapsn	A	G	2: 91,044,948	T359A	probably benign	Het
Setd6	A	T	8: 95,716,238	H101L	probably benign	Het
Sez6	T	C	11: 77,974,549	S671P	probably damaging	Het
Son	T	C	16: 91,656,528	L721S	probably damaging	Het
Spata31d1b	A	T	13: 59,717,233	R732W	possibly damaging	Het
Srd5a3	T	A	5: 76,154,771	F328I	probably damaging	Het
Tfap2b	G	A	1: 19,234,307	G447D	probably damaging	Het
Thoc3	A	C	13: 54,463,778	F232C	probably damaging	Het
Tmem69	A	G	4: 116,553,398	L125P	probably damaging	Het
Tnfsf13	C	T	11: 69,685,163	V33M	probably damaging	Het
Togaram2	T	A	17: 71,704,751	M476K	probably benign	Het
Tube1	A	G	10: 39,142,298	I124V	probably benign	Het
Uevld	A	T	7: 46,926,352	I462N	probably damaging	Het
Utrn	G	A	10: 12,486,610	R2660C	probably damaging	Het
Vcan	T	C	13: 89,688,654	T2924A	probably damaging	Het
Vmn2r120	T	C	17: 57,525,942	Y79C	probably damaging	Het
Vwa8	T	C	14: 79,038,147	V790A	probably benign	Het
Zfp874b	A	G	13: 67,473,974	F402L	probably benign	Het
Zfp936	A	G	7: 43,190,296	T396A	possibly damaging	Het
Zfp978	T	C	4: 147,385,303		probably null	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCTTCAGCAATCCTTTG -3'
(R):5'- TGTAGGGCTCAATGTAGGGC -3'

Sequencing Primer
(F):5'- GTCCAGCACACAGGTATCTTG -3'
(R):5'- GCATCTTTGGGTACTCACAAAACGG -3'

Posted On

2019-11-26