Incidental Mutation 'R7778:Ep300'
ID599027
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7778 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81586686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 20 (S20P)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: S20P
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: S20P

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,739,511 S524P possibly damaging Het
Aplf A C 6: 87,658,202 probably null Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Elmo1 A G 13: 20,589,642 probably null Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kcnt1 T G 2: 25,901,889 I617S probably benign Het
Lama1 T A 17: 67,804,473 S2240T Het
Lcn2 T C 2: 32,387,915 D55G probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr748 G T 14: 50,710,471 C47F possibly damaging Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prkcd C T 14: 30,605,815 probably null Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Tmem69 A G 4: 116,553,398 L125P probably damaging Het
Tnfsf13 C T 11: 69,685,163 V33M probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Zfp978 T C 4: 147,385,303 probably null Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7945:Ep300 UTSW 15 81650753 missense probably damaging 1.00
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCATTTCTGTTGAGTCCGC -3'
(R):5'- GACGTCTTCGACCAGTCCATTC -3'

Sequencing Primer
(F):5'- CTGTTGAGTCCGCATCCC -3'
(R):5'- GTCTTCGACCAGTCCATTCAAAAAC -3'
Posted On2019-11-26