Incidental Mutation 'R7778:Togaram2'
ID599034
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7778 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71704751 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 476 (M476K)
Ref Sequence ENSEMBL: ENSMUSP00000114359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
AA Change: M475K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: M475K

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144479
AA Change: M476K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: M476K

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
AA Change: M475K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: M475K

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,739,511 S524P possibly damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Elmo1 A G 13: 20,589,642 probably null Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kcnt1 T G 2: 25,901,889 I617S probably benign Het
Lama1 T A 17: 67,804,473 S2240T Het
Lcn2 T C 2: 32,387,915 D55G probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr748 G T 14: 50,710,471 C47F possibly damaging Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prkcd C T 14: 30,605,815 probably null Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Tmem69 A G 4: 116,553,398 L125P probably damaging Het
Tnfsf13 C T 11: 69,685,163 V33M probably damaging Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Zfp978 T C 4: 147,385,303 probably null Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4066:Togaram2 UTSW 17 71716238 intron probably benign
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71689209 missense probably benign 0.00
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6682:Togaram2 UTSW 17 71704754 missense probably benign 0.04
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7015:Togaram2 UTSW 17 71709568 missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
R7383:Togaram2 UTSW 17 71700517 missense probably damaging 1.00
R7691:Togaram2 UTSW 17 71716410 missense probably benign 0.16
R7824:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7862:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7864:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
R7945:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7947:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 71701002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCAGGTAGAGCTGGCTG -3'
(R):5'- GGGCAGGACATCTTCTGTAG -3'

Sequencing Primer
(F):5'- GCCAGGCTCTTCAGTGTCTG -3'
(R):5'- GCAGGACATCTTCTGTAGCCCTC -3'
Posted On2019-11-26