Incidental Mutation 'R7779:Cacna1s'
ID 599039
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Name calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms mdg, muscle dysgenesis, sj, Cav1.1, Cchl1a3, DHPR alpha1s, fmd
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 135980549-136047268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 136046767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1799 (A1799T)
Ref Sequence ENSEMBL: ENSMUSP00000107699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112064
AA Change: A1820T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: A1820T

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112068
AA Change: A1799T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: A1799T

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160641
AA Change: A1818T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: A1818T

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161865
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136,012,011 (GRCm39) nonsense probably null
IGL00517:Cacna1s APN 1 136,015,077 (GRCm39) missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136,046,702 (GRCm39) missense probably benign 0.01
IGL01348:Cacna1s APN 1 136,002,890 (GRCm39) missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136,024,870 (GRCm39) critical splice donor site probably null
IGL01773:Cacna1s APN 1 136,046,491 (GRCm39) missense probably benign 0.32
IGL02056:Cacna1s APN 1 136,046,738 (GRCm39) missense probably benign
IGL02262:Cacna1s APN 1 136,035,867 (GRCm39) missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136,002,914 (GRCm39) splice site probably benign
IGL02352:Cacna1s APN 1 136,020,990 (GRCm39) splice site probably benign
IGL02359:Cacna1s APN 1 136,020,990 (GRCm39) splice site probably benign
IGL02370:Cacna1s APN 1 136,013,085 (GRCm39) missense probably damaging 1.00
IGL02377:Cacna1s APN 1 135,996,732 (GRCm39) missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136,046,118 (GRCm39) missense probably benign
IGL02606:Cacna1s APN 1 136,007,257 (GRCm39) missense probably damaging 0.99
IGL02833:Cacna1s APN 1 135,998,743 (GRCm39) missense probably benign 0.03
IGL02974:Cacna1s APN 1 136,020,355 (GRCm39) missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136,039,731 (GRCm39) missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136,043,802 (GRCm39) missense probably benign 0.00
IGL03286:Cacna1s APN 1 136,005,397 (GRCm39) missense probably benign
brookstone UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
flyfish UTSW 1 136,043,799 (GRCm39) missense probably benign 0.21
forelle UTSW 1 136,023,596 (GRCm39) missense probably damaging 0.99
river UTSW 1 136,033,582 (GRCm39) missense possibly damaging 0.88
stream UTSW 1 136,033,552 (GRCm39) missense probably damaging 1.00
BB009:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
G1Funyon:Cacna1s UTSW 1 136,001,179 (GRCm39) unclassified probably benign
N/A:Cacna1s UTSW 1 136,001,247 (GRCm39) missense probably benign 0.00
R0030:Cacna1s UTSW 1 136,022,727 (GRCm39) critical splice donor site probably null
R0030:Cacna1s UTSW 1 136,022,727 (GRCm39) critical splice donor site probably null
R0097:Cacna1s UTSW 1 136,028,360 (GRCm39) missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136,028,360 (GRCm39) missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136,001,234 (GRCm39) unclassified probably benign
R0255:Cacna1s UTSW 1 136,046,544 (GRCm39) missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136,028,342 (GRCm39) missense probably benign 0.01
R0319:Cacna1s UTSW 1 135,998,455 (GRCm39) missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136,041,041 (GRCm39) missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136,025,947 (GRCm39) missense probably benign 0.00
R0482:Cacna1s UTSW 1 136,041,132 (GRCm39) missense probably benign
R0491:Cacna1s UTSW 1 136,016,746 (GRCm39) splice site probably benign
R0518:Cacna1s UTSW 1 136,004,597 (GRCm39) missense probably benign
R0717:Cacna1s UTSW 1 136,026,029 (GRCm39) missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136,026,264 (GRCm39) splice site probably benign
R0815:Cacna1s UTSW 1 136,040,695 (GRCm39) missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136,022,709 (GRCm39) missense probably benign 0.02
R1518:Cacna1s UTSW 1 136,026,289 (GRCm39) missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136,038,675 (GRCm39) missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136,026,361 (GRCm39) missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1729:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1730:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1739:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1762:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1783:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1784:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1785:Cacna1s UTSW 1 136,046,454 (GRCm39) missense probably benign
R1800:Cacna1s UTSW 1 136,004,592 (GRCm39) missense probably benign
R1924:Cacna1s UTSW 1 136,016,755 (GRCm39) splice site probably null
R1969:Cacna1s UTSW 1 136,046,833 (GRCm39) missense probably benign 0.42
R2072:Cacna1s UTSW 1 136,007,242 (GRCm39) missense probably benign
R2380:Cacna1s UTSW 1 136,023,586 (GRCm39) missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136,002,831 (GRCm39) nonsense probably null
R3112:Cacna1s UTSW 1 136,002,831 (GRCm39) nonsense probably null
R3151:Cacna1s UTSW 1 136,033,532 (GRCm39) missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136,033,552 (GRCm39) missense probably damaging 1.00
R3722:Cacna1s UTSW 1 135,996,780 (GRCm39) missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136,034,756 (GRCm39) missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136,013,085 (GRCm39) missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136,012,007 (GRCm39) missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136,035,933 (GRCm39) missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136,046,771 (GRCm39) missense probably benign 0.00
R4485:Cacna1s UTSW 1 136,004,590 (GRCm39) missense probably damaging 1.00
R4581:Cacna1s UTSW 1 135,998,708 (GRCm39) splice site probably null
R4719:Cacna1s UTSW 1 136,046,390 (GRCm39) splice site probably benign
R4816:Cacna1s UTSW 1 136,043,007 (GRCm39) missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136,007,342 (GRCm39) missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136,029,302 (GRCm39) critical splice donor site probably null
R5296:Cacna1s UTSW 1 136,023,523 (GRCm39) missense probably benign 0.11
R5411:Cacna1s UTSW 1 136,033,549 (GRCm39) missense probably benign 0.09
R5503:Cacna1s UTSW 1 136,014,480 (GRCm39) missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136,026,113 (GRCm39) critical splice donor site probably null
R5714:Cacna1s UTSW 1 136,039,804 (GRCm39) missense probably benign 0.44
R5775:Cacna1s UTSW 1 136,035,860 (GRCm39) missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136,034,880 (GRCm39) missense probably benign 0.31
R5820:Cacna1s UTSW 1 136,007,342 (GRCm39) missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136,039,816 (GRCm39) missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136,028,405 (GRCm39) missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136,004,560 (GRCm39) missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136,034,225 (GRCm39) missense probably benign 0.15
R6037:Cacna1s UTSW 1 135,998,705 (GRCm39) missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 135,998,705 (GRCm39) missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136,033,574 (GRCm39) missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136,004,496 (GRCm39) missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136,032,360 (GRCm39) missense probably benign 0.00
R6237:Cacna1s UTSW 1 136,033,582 (GRCm39) missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136,016,783 (GRCm39) missense probably benign 0.02
R6609:Cacna1s UTSW 1 136,041,129 (GRCm39) missense probably benign 0.30
R6626:Cacna1s UTSW 1 136,022,703 (GRCm39) missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136,012,175 (GRCm39) missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6849:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6850:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6851:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6868:Cacna1s UTSW 1 136,020,432 (GRCm39) missense probably benign 0.01
R6879:Cacna1s UTSW 1 136,043,697 (GRCm39) missense probably benign 0.12
R6893:Cacna1s UTSW 1 136,005,431 (GRCm39) missense probably benign 0.05
R7017:Cacna1s UTSW 1 136,023,596 (GRCm39) missense probably damaging 0.99
R7228:Cacna1s UTSW 1 135,998,797 (GRCm39) missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136,001,446 (GRCm39) missense probably damaging 1.00
R7357:Cacna1s UTSW 1 135,998,759 (GRCm39) missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136,020,371 (GRCm39) missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136,014,540 (GRCm39) missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136,013,187 (GRCm39) nonsense probably null
R7519:Cacna1s UTSW 1 135,998,494 (GRCm39) missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136,038,612 (GRCm39) missense probably damaging 1.00
R7746:Cacna1s UTSW 1 135,996,756 (GRCm39) missense probably damaging 0.99
R7850:Cacna1s UTSW 1 135,998,786 (GRCm39) missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136,012,097 (GRCm39) missense probably damaging 0.99
R7935:Cacna1s UTSW 1 136,020,333 (GRCm39) missense possibly damaging 0.62
R7950:Cacna1s UTSW 1 136,028,363 (GRCm39) missense probably benign 0.01
R7969:Cacna1s UTSW 1 136,004,470 (GRCm39) missense probably damaging 1.00
R8083:Cacna1s UTSW 1 136,023,529 (GRCm39) missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136,046,403 (GRCm39) missense probably benign 0.02
R8123:Cacna1s UTSW 1 136,035,917 (GRCm39) missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136,035,893 (GRCm39) missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136,005,430 (GRCm39) missense probably benign 0.33
R8251:Cacna1s UTSW 1 136,014,461 (GRCm39) missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136,020,364 (GRCm39) nonsense probably null
R8301:Cacna1s UTSW 1 136,001,179 (GRCm39) unclassified probably benign
R8310:Cacna1s UTSW 1 136,015,075 (GRCm39) missense probably damaging 1.00
R8359:Cacna1s UTSW 1 136,043,799 (GRCm39) missense probably benign 0.21
R8461:Cacna1s UTSW 1 136,001,440 (GRCm39) missense possibly damaging 0.53
R8553:Cacna1s UTSW 1 136,019,540 (GRCm39) missense possibly damaging 0.93
R8743:Cacna1s UTSW 1 136,033,286 (GRCm39) missense probably damaging 1.00
R8766:Cacna1s UTSW 1 136,002,881 (GRCm39) missense probably damaging 1.00
R8884:Cacna1s UTSW 1 136,042,981 (GRCm39) missense probably benign 0.05
R8897:Cacna1s UTSW 1 136,045,392 (GRCm39) missense probably benign 0.01
R8939:Cacna1s UTSW 1 136,014,544 (GRCm39) critical splice donor site probably null
R8953:Cacna1s UTSW 1 136,025,170 (GRCm39) missense possibly damaging 0.94
R9039:Cacna1s UTSW 1 136,016,057 (GRCm39) missense probably benign
R9058:Cacna1s UTSW 1 135,998,436 (GRCm39) nonsense probably null
R9137:Cacna1s UTSW 1 135,996,744 (GRCm39) missense possibly damaging 0.89
R9332:Cacna1s UTSW 1 136,020,452 (GRCm39) nonsense probably null
R9416:Cacna1s UTSW 1 136,022,689 (GRCm39) missense possibly damaging 0.88
R9427:Cacna1s UTSW 1 136,012,090 (GRCm39) missense probably benign 0.30
R9446:Cacna1s UTSW 1 136,045,362 (GRCm39) missense probably benign 0.00
R9564:Cacna1s UTSW 1 136,046,516 (GRCm39) missense probably benign
R9620:Cacna1s UTSW 1 136,035,909 (GRCm39) missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136,043,708 (GRCm39) missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136,034,822 (GRCm39) nonsense probably null
Z1177:Cacna1s UTSW 1 136,045,424 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACAGAGCGGCATACTCAG -3'
(R):5'- AAGCTTGTGTCATTCTGTATAGGC -3'

Sequencing Primer
(F):5'- GCGGCATACTCAGGAGTG -3'
(R):5'- TATAGGCCTCACATCTGGGAG -3'
Posted On 2019-11-26