Incidental Mutation 'R7779:Etl4'
ID 599045
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, Sickle tail, E330027G05Rik, Etl-4, Skt, 9430077C05Rik
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.809) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 19915018-20815346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20714288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 129 (T129I)
Ref Sequence ENSEMBL: ENSMUSP00000110257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
AlphaFold A2AQ25
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: T129I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: T129I

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: T260I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: T260I

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.2477 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20,771,289 (GRCm39) missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20,534,865 (GRCm39) missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20,811,342 (GRCm39) nonsense probably null
IGL01099:Etl4 APN 2 20,811,922 (GRCm39) missense probably benign 0.06
IGL01337:Etl4 APN 2 20,790,198 (GRCm39) missense probably benign 0.01
IGL01348:Etl4 APN 2 20,811,784 (GRCm39) missense probably damaging 1.00
IGL01349:Etl4 APN 2 20,718,207 (GRCm39) missense probably damaging 1.00
IGL01407:Etl4 APN 2 20,748,667 (GRCm39) missense probably damaging 0.99
IGL01552:Etl4 APN 2 20,783,000 (GRCm39) missense probably damaging 0.99
IGL01662:Etl4 APN 2 20,811,460 (GRCm39) missense probably benign 0.04
IGL01687:Etl4 APN 2 20,534,898 (GRCm39) missense probably damaging 1.00
IGL01793:Etl4 APN 2 20,748,709 (GRCm39) missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20,811,493 (GRCm39) missense probably benign 0.06
IGL02025:Etl4 APN 2 20,811,337 (GRCm39) missense probably damaging 1.00
IGL02088:Etl4 APN 2 20,811,359 (GRCm39) missense probably damaging 1.00
IGL02134:Etl4 APN 2 20,811,240 (GRCm39) missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20,535,000 (GRCm39) missense probably damaging 1.00
IGL02480:Etl4 APN 2 20,793,335 (GRCm39) missense probably damaging 0.99
IGL02560:Etl4 APN 2 20,748,529 (GRCm39) missense probably damaging 1.00
IGL02851:Etl4 APN 2 20,812,840 (GRCm39) missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20,765,021 (GRCm39) splice site probably benign
IGL02951:Etl4 APN 2 20,806,348 (GRCm39) splice site probably benign
IGL03119:Etl4 APN 2 20,718,198 (GRCm39) missense probably damaging 1.00
IGL03267:Etl4 APN 2 20,789,993 (GRCm39) nonsense probably null
IGL03379:Etl4 APN 2 20,666,827 (GRCm39) missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0095:Etl4 UTSW 2 20,748,679 (GRCm39) missense probably damaging 1.00
R0100:Etl4 UTSW 2 20,344,716 (GRCm39) missense probably benign
R0311:Etl4 UTSW 2 20,811,940 (GRCm39) missense probably damaging 1.00
R0346:Etl4 UTSW 2 20,764,463 (GRCm39) critical splice donor site probably null
R0348:Etl4 UTSW 2 20,782,940 (GRCm39) missense probably damaging 1.00
R0379:Etl4 UTSW 2 20,812,165 (GRCm39) missense probably damaging 0.98
R0571:Etl4 UTSW 2 20,748,580 (GRCm39) missense probably damaging 0.99
R0697:Etl4 UTSW 2 20,748,672 (GRCm39) missense probably damaging 1.00
R0707:Etl4 UTSW 2 20,810,382 (GRCm39) splice site probably benign
R0980:Etl4 UTSW 2 20,806,378 (GRCm39) missense probably damaging 1.00
R1120:Etl4 UTSW 2 20,811,514 (GRCm39) missense probably benign 0.00
R1254:Etl4 UTSW 2 20,812,734 (GRCm39) missense probably damaging 1.00
R1346:Etl4 UTSW 2 20,810,955 (GRCm39) missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20,793,288 (GRCm39) missense probably damaging 1.00
R1503:Etl4 UTSW 2 20,748,685 (GRCm39) missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R1627:Etl4 UTSW 2 20,806,390 (GRCm39) missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20,811,219 (GRCm39) missense probably damaging 1.00
R1716:Etl4 UTSW 2 20,748,492 (GRCm39) missense probably damaging 1.00
R1795:Etl4 UTSW 2 20,812,837 (GRCm39) critical splice donor site probably null
R1885:Etl4 UTSW 2 20,748,795 (GRCm39) missense probably damaging 1.00
R2039:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R2083:Etl4 UTSW 2 20,748,360 (GRCm39) missense probably damaging 1.00
R2109:Etl4 UTSW 2 20,790,153 (GRCm39) missense probably benign 0.27
R2153:Etl4 UTSW 2 20,803,545 (GRCm39) missense probably benign 0.00
R2403:Etl4 UTSW 2 20,812,117 (GRCm39) nonsense probably null
R2883:Etl4 UTSW 2 20,810,985 (GRCm39) missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20,786,660 (GRCm39) missense probably damaging 1.00
R3402:Etl4 UTSW 2 20,786,693 (GRCm39) missense probably damaging 1.00
R3696:Etl4 UTSW 2 20,806,473 (GRCm39) critical splice donor site probably null
R3755:Etl4 UTSW 2 20,748,348 (GRCm39) missense probably benign 0.10
R3813:Etl4 UTSW 2 20,793,246 (GRCm39) missense probably damaging 1.00
R3829:Etl4 UTSW 2 20,790,232 (GRCm39) missense probably benign 0.07
R3887:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3888:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3889:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3958:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3959:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3960:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R4058:Etl4 UTSW 2 20,810,830 (GRCm39) missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20,814,030 (GRCm39) utr 3 prime probably benign
R4077:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4078:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4127:Etl4 UTSW 2 20,748,886 (GRCm39) missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20,786,694 (GRCm39) missense probably damaging 1.00
R4492:Etl4 UTSW 2 20,811,676 (GRCm39) missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20,666,709 (GRCm39) missense probably damaging 1.00
R4820:Etl4 UTSW 2 20,811,496 (GRCm39) missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20,811,738 (GRCm39) missense probably damaging 1.00
R4888:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R4938:Etl4 UTSW 2 20,803,460 (GRCm39) missense probably benign 0.00
R4943:Etl4 UTSW 2 20,812,092 (GRCm39) missense probably benign 0.05
R5121:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R5191:Etl4 UTSW 2 20,344,810 (GRCm39) missense probably damaging 0.99
R5198:Etl4 UTSW 2 20,718,198 (GRCm39) missense probably damaging 1.00
R5199:Etl4 UTSW 2 20,748,853 (GRCm39) missense probably damaging 1.00
R5470:Etl4 UTSW 2 20,534,791 (GRCm39) missense probably damaging 0.99
R5513:Etl4 UTSW 2 20,748,638 (GRCm39) missense probably damaging 1.00
R5620:Etl4 UTSW 2 20,535,037 (GRCm39) missense probably damaging 1.00
R5635:Etl4 UTSW 2 20,811,846 (GRCm39) missense probably damaging 1.00
R5641:Etl4 UTSW 2 20,811,273 (GRCm39) frame shift probably null
R5690:Etl4 UTSW 2 20,810,647 (GRCm39) missense probably benign 0.01
R5784:Etl4 UTSW 2 20,811,016 (GRCm39) missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20,811,323 (GRCm39) missense probably damaging 1.00
R5908:Etl4 UTSW 2 20,748,718 (GRCm39) missense probably damaging 0.96
R5982:Etl4 UTSW 2 20,785,826 (GRCm39) missense probably damaging 1.00
R6151:Etl4 UTSW 2 20,718,171 (GRCm39) missense probably damaging 1.00
R6192:Etl4 UTSW 2 20,806,362 (GRCm39) missense probably damaging 0.98
R6238:Etl4 UTSW 2 20,806,379 (GRCm39) missense probably damaging 1.00
R6248:Etl4 UTSW 2 20,813,900 (GRCm39) missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20,748,384 (GRCm39) missense probably damaging 1.00
R6610:Etl4 UTSW 2 20,718,180 (GRCm39) missense probably damaging 1.00
R6739:Etl4 UTSW 2 20,718,246 (GRCm39) missense probably damaging 1.00
R6846:Etl4 UTSW 2 20,748,919 (GRCm39) missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20,811,120 (GRCm39) missense probably benign 0.01
R6873:Etl4 UTSW 2 20,802,803 (GRCm39) splice site probably null
R7003:Etl4 UTSW 2 20,810,695 (GRCm39) missense probably benign 0.03
R7155:Etl4 UTSW 2 20,811,742 (GRCm39) missense probably damaging 0.96
R7207:Etl4 UTSW 2 20,714,387 (GRCm39) missense probably damaging 0.99
R7230:Etl4 UTSW 2 20,802,799 (GRCm39) missense probably damaging 1.00
R7305:Etl4 UTSW 2 20,714,368 (GRCm39) missense probably damaging 1.00
R7389:Etl4 UTSW 2 20,789,904 (GRCm39) nonsense probably null
R7396:Etl4 UTSW 2 20,803,449 (GRCm39) missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20,749,000 (GRCm39) missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20,718,189 (GRCm39) missense probably damaging 1.00
R7776:Etl4 UTSW 2 20,811,957 (GRCm39) missense probably damaging 0.99
R7798:Etl4 UTSW 2 20,786,757 (GRCm39) critical splice donor site probably null
R7851:Etl4 UTSW 2 20,748,951 (GRCm39) missense probably damaging 1.00
R7861:Etl4 UTSW 2 20,810,721 (GRCm39) missense probably benign
R7901:Etl4 UTSW 2 20,294,821 (GRCm39) missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20,666,774 (GRCm39) missense probably damaging 1.00
R8124:Etl4 UTSW 2 20,811,451 (GRCm39) missense probably benign 0.06
R8133:Etl4 UTSW 2 20,811,082 (GRCm39) missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20,789,916 (GRCm39) missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20,811,342 (GRCm39) nonsense probably null
R8263:Etl4 UTSW 2 20,748,965 (GRCm39) missense probably benign 0.00
R8299:Etl4 UTSW 2 20,748,874 (GRCm39) missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20,793,341 (GRCm39) missense probably damaging 1.00
R8334:Etl4 UTSW 2 20,785,857 (GRCm39) missense probably damaging 0.96
R8443:Etl4 UTSW 2 20,810,977 (GRCm39) missense probably benign 0.04
R8525:Etl4 UTSW 2 20,534,892 (GRCm39) missense probably damaging 1.00
R8679:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R8918:Etl4 UTSW 2 20,811,246 (GRCm39) missense probably benign 0.00
R8918:Etl4 UTSW 2 20,748,733 (GRCm39) missense probably benign
R9062:Etl4 UTSW 2 20,748,616 (GRCm39) missense probably damaging 0.99
R9095:Etl4 UTSW 2 20,782,964 (GRCm39) missense probably damaging 1.00
R9200:Etl4 UTSW 2 20,786,702 (GRCm39) missense probably damaging 1.00
R9416:Etl4 UTSW 2 20,748,784 (GRCm39) missense probably benign 0.17
R9437:Etl4 UTSW 2 20,813,872 (GRCm39) missense probably benign 0.20
R9451:Etl4 UTSW 2 20,813,926 (GRCm39) missense probably benign 0.03
R9489:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9531:Etl4 UTSW 2 20,294,818 (GRCm39) start codon destroyed probably null 0.01
R9605:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9623:Etl4 UTSW 2 20,811,052 (GRCm39) missense
R9631:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9632:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9646:Etl4 UTSW 2 20,802,724 (GRCm39) missense probably benign 0.00
R9732:Etl4 UTSW 2 20,748,373 (GRCm39) missense probably damaging 0.98
R9755:Etl4 UTSW 2 20,790,048 (GRCm39) missense probably benign 0.17
R9771:Etl4 UTSW 2 20,811,537 (GRCm39) missense probably benign
RF003:Etl4 UTSW 2 20,524,729 (GRCm39) nonsense probably null
X0018:Etl4 UTSW 2 20,814,001 (GRCm39) missense probably damaging 0.98
X0022:Etl4 UTSW 2 20,714,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGGAGAAAGCATCGGC -3'
(R):5'- CGCTAGACATTCAATACAGTGGTC -3'

Sequencing Primer
(F):5'- CAGAGTCACTGCAGTGTGG -3'
(R):5'- GACATTCAATACAGTGGTCAATGAC -3'
Posted On 2019-11-26