Incidental Mutation 'R7779:Etl4'
ID599045
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20709477 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 129 (T129I)
Ref Sequence ENSEMBL: ENSMUSP00000110257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: T129I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: T129I

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: T209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: T209I

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: T260I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: T260I

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Capn1 T C 19: 5,994,086 K535E probably benign Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
Grin2b A T 6: 135,778,794 Y507* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Itpr3 A T 17: 27,096,063 Y728F probably damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Olfr794 A T 10: 129,571,311 I219F probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps13c G A 9: 67,881,422 V326M probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
R7389:Etl4 UTSW 2 20785093 nonsense probably null
R7396:Etl4 UTSW 2 20798638 missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20744189 missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20713378 missense probably damaging 1.00
R7776:Etl4 UTSW 2 20807146 missense probably damaging 0.99
R7798:Etl4 UTSW 2 20781946 critical splice donor site probably null
R7851:Etl4 UTSW 2 20744140 missense probably damaging 1.00
R7861:Etl4 UTSW 2 20805910 missense probably benign
R7901:Etl4 UTSW 2 20290010 missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20661963 missense probably damaging 1.00
R8124:Etl4 UTSW 2 20806640 missense probably benign 0.06
R8133:Etl4 UTSW 2 20806271 missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20785105 missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20806531 nonsense probably null
R8263:Etl4 UTSW 2 20744154 missense probably benign 0.00
R8299:Etl4 UTSW 2 20744063 missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20788530 missense probably damaging 1.00
RF003:Etl4 UTSW 2 20519918 nonsense probably null
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGGAGAAAGCATCGGC -3'
(R):5'- CGCTAGACATTCAATACAGTGGTC -3'

Sequencing Primer
(F):5'- CAGAGTCACTGCAGTGTGG -3'
(R):5'- GACATTCAATACAGTGGTCAATGAC -3'
Posted On2019-11-26