Incidental Mutation 'R7779:Spg11'
ID 599050
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene Name SPG11, spatacsin vesicle trafficking associated
Synonyms 6030465E24Rik, C530005A01Rik, spastic paraplegia 11
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121884001-121948867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121901420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1507 (S1507P)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
AlphaFold Q3UHA3
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: S1507P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: S1507P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 121,896,041 (GRCm39) missense probably damaging 0.96
IGL00495:Spg11 APN 2 121,924,937 (GRCm39) critical splice donor site probably null
IGL00757:Spg11 APN 2 121,901,440 (GRCm39) missense probably benign 0.05
IGL01304:Spg11 APN 2 121,902,771 (GRCm39) missense probably damaging 1.00
IGL01355:Spg11 APN 2 121,943,637 (GRCm39) missense probably benign
IGL01626:Spg11 APN 2 121,891,452 (GRCm39) missense probably damaging 0.98
IGL01739:Spg11 APN 2 121,945,152 (GRCm39) missense probably damaging 1.00
IGL01835:Spg11 APN 2 121,918,705 (GRCm39) missense probably benign 0.36
IGL02129:Spg11 APN 2 121,926,167 (GRCm39) missense probably damaging 0.99
IGL02178:Spg11 APN 2 121,927,783 (GRCm39) missense probably damaging 1.00
IGL02199:Spg11 APN 2 121,890,034 (GRCm39) missense probably damaging 1.00
IGL02212:Spg11 APN 2 121,938,638 (GRCm39) missense probably benign 0.31
IGL02605:Spg11 APN 2 121,922,741 (GRCm39) missense probably benign 0.00
IGL02635:Spg11 APN 2 121,943,549 (GRCm39) missense possibly damaging 0.52
IGL02743:Spg11 APN 2 121,889,988 (GRCm39) missense probably damaging 0.97
IGL02822:Spg11 APN 2 121,905,015 (GRCm39) missense probably damaging 0.99
IGL02992:Spg11 APN 2 121,888,879 (GRCm39) missense probably damaging 1.00
IGL03010:Spg11 APN 2 121,918,801 (GRCm39) missense probably damaging 0.96
3-1:Spg11 UTSW 2 121,917,371 (GRCm39) missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 121,918,666 (GRCm39) missense probably damaging 0.98
R0131:Spg11 UTSW 2 121,901,449 (GRCm39) missense probably damaging 1.00
R0206:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0208:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0302:Spg11 UTSW 2 121,922,668 (GRCm39) missense possibly damaging 0.90
R0347:Spg11 UTSW 2 121,927,850 (GRCm39) missense probably damaging 0.99
R0357:Spg11 UTSW 2 121,896,713 (GRCm39) splice site probably benign
R0372:Spg11 UTSW 2 121,889,928 (GRCm39) frame shift probably null
R0715:Spg11 UTSW 2 121,915,464 (GRCm39) missense probably benign 0.03
R0927:Spg11 UTSW 2 121,924,968 (GRCm39) missense probably damaging 0.99
R1163:Spg11 UTSW 2 121,901,422 (GRCm39) missense probably damaging 1.00
R1534:Spg11 UTSW 2 121,922,806 (GRCm39) missense probably damaging 1.00
R1555:Spg11 UTSW 2 121,927,858 (GRCm39) missense probably damaging 0.99
R1569:Spg11 UTSW 2 121,932,187 (GRCm39) missense probably damaging 0.99
R1840:Spg11 UTSW 2 121,932,237 (GRCm39) missense probably damaging 1.00
R1929:Spg11 UTSW 2 121,890,688 (GRCm39) missense probably damaging 1.00
R2265:Spg11 UTSW 2 121,938,788 (GRCm39) missense possibly damaging 0.48
R2303:Spg11 UTSW 2 121,899,318 (GRCm39) missense probably damaging 0.99
R2510:Spg11 UTSW 2 121,905,791 (GRCm39) missense probably benign 0.03
R2760:Spg11 UTSW 2 121,927,840 (GRCm39) missense probably damaging 0.99
R2918:Spg11 UTSW 2 121,905,782 (GRCm39) missense probably damaging 0.99
R3195:Spg11 UTSW 2 121,913,879 (GRCm39) critical splice donor site probably null
R3423:Spg11 UTSW 2 121,901,534 (GRCm39) missense probably benign 0.00
R4353:Spg11 UTSW 2 121,943,675 (GRCm39) missense possibly damaging 0.92
R4407:Spg11 UTSW 2 121,905,813 (GRCm39) missense probably benign 0.00
R4644:Spg11 UTSW 2 121,891,510 (GRCm39) missense probably benign 0.03
R4663:Spg11 UTSW 2 121,928,580 (GRCm39) critical splice donor site probably null
R4684:Spg11 UTSW 2 121,895,557 (GRCm39) missense probably damaging 1.00
R4771:Spg11 UTSW 2 121,895,963 (GRCm39) nonsense probably null
R4810:Spg11 UTSW 2 121,890,277 (GRCm39) missense probably damaging 1.00
R4829:Spg11 UTSW 2 121,938,936 (GRCm39) missense probably benign 0.44
R5089:Spg11 UTSW 2 121,945,198 (GRCm39) nonsense probably null
R5362:Spg11 UTSW 2 121,891,481 (GRCm39) missense probably damaging 0.99
R5684:Spg11 UTSW 2 121,923,984 (GRCm39) missense probably damaging 1.00
R5899:Spg11 UTSW 2 121,928,680 (GRCm39) missense possibly damaging 0.67
R5923:Spg11 UTSW 2 121,923,959 (GRCm39) missense probably damaging 0.98
R6052:Spg11 UTSW 2 121,927,837 (GRCm39) missense probably damaging 0.99
R6111:Spg11 UTSW 2 121,923,963 (GRCm39) missense probably damaging 0.98
R6174:Spg11 UTSW 2 121,917,286 (GRCm39) splice site probably null
R6226:Spg11 UTSW 2 121,918,743 (GRCm39) missense possibly damaging 0.69
R6336:Spg11 UTSW 2 121,943,440 (GRCm39) splice site probably null
R6480:Spg11 UTSW 2 121,922,786 (GRCm39) missense probably benign 0.03
R6494:Spg11 UTSW 2 121,943,706 (GRCm39) missense probably damaging 0.98
R6582:Spg11 UTSW 2 121,922,773 (GRCm39) missense probably damaging 0.99
R6714:Spg11 UTSW 2 121,926,212 (GRCm39) missense probably damaging 0.99
R6791:Spg11 UTSW 2 121,923,924 (GRCm39) missense probably damaging 0.99
R6836:Spg11 UTSW 2 121,890,016 (GRCm39) missense probably damaging 1.00
R6928:Spg11 UTSW 2 121,900,385 (GRCm39) missense probably benign 0.37
R7179:Spg11 UTSW 2 121,932,270 (GRCm39) splice site probably null
R7229:Spg11 UTSW 2 121,938,585 (GRCm39) missense probably damaging 0.98
R7337:Spg11 UTSW 2 121,915,474 (GRCm39) missense probably benign 0.09
R7338:Spg11 UTSW 2 121,885,858 (GRCm39) missense probably damaging 1.00
R7351:Spg11 UTSW 2 121,900,412 (GRCm39) missense possibly damaging 0.95
R7378:Spg11 UTSW 2 121,888,910 (GRCm39) missense probably damaging 1.00
R7448:Spg11 UTSW 2 121,924,026 (GRCm39) critical splice acceptor site probably null
R7505:Spg11 UTSW 2 121,905,832 (GRCm39) nonsense probably null
R7665:Spg11 UTSW 2 121,896,748 (GRCm39) missense probably damaging 0.99
R7685:Spg11 UTSW 2 121,899,361 (GRCm39) missense probably damaging 0.99
R7947:Spg11 UTSW 2 121,922,803 (GRCm39) missense probably damaging 1.00
R7958:Spg11 UTSW 2 121,923,426 (GRCm39) splice site probably null
R8024:Spg11 UTSW 2 121,927,802 (GRCm39) missense possibly damaging 0.67
R8033:Spg11 UTSW 2 121,917,432 (GRCm39) missense probably damaging 1.00
R8069:Spg11 UTSW 2 121,943,637 (GRCm39) missense probably benign
R8121:Spg11 UTSW 2 121,900,348 (GRCm39) critical splice donor site probably null
R8252:Spg11 UTSW 2 121,918,820 (GRCm39) splice site probably benign
R8358:Spg11 UTSW 2 121,910,739 (GRCm39) missense possibly damaging 0.69
R8362:Spg11 UTSW 2 121,948,842 (GRCm39) missense unknown
R8385:Spg11 UTSW 2 121,927,802 (GRCm39) missense probably benign 0.22
R8406:Spg11 UTSW 2 121,923,923 (GRCm39) missense probably damaging 0.99
R8480:Spg11 UTSW 2 121,943,560 (GRCm39) missense probably damaging 1.00
R8810:Spg11 UTSW 2 121,901,425 (GRCm39) missense probably damaging 0.98
R8883:Spg11 UTSW 2 121,943,561 (GRCm39) missense probably damaging 1.00
R8968:Spg11 UTSW 2 121,922,687 (GRCm39) missense probably damaging 0.99
R9008:Spg11 UTSW 2 121,900,413 (GRCm39) missense probably benign 0.05
R9059:Spg11 UTSW 2 121,918,788 (GRCm39) missense probably damaging 0.99
R9296:Spg11 UTSW 2 121,945,175 (GRCm39) missense probably benign 0.34
R9333:Spg11 UTSW 2 121,932,244 (GRCm39) missense probably damaging 0.99
R9657:Spg11 UTSW 2 121,910,781 (GRCm39) missense probably damaging 1.00
R9774:Spg11 UTSW 2 121,938,965 (GRCm39) missense probably damaging 0.99
Z1177:Spg11 UTSW 2 121,903,466 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTATGTTGACACCCTGAGG -3'
(R):5'- GGGGAAGGTTTTCTCACAAGCTG -3'

Sequencing Primer
(F):5'- CCCTGAGGTTCTGGAATGTC -3'
(R):5'- GGAAGGTTTTCTCACAAGCTGATTCC -3'
Posted On 2019-11-26