Incidental Mutation 'R7779:Grin2b'
ID599073
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 135778794 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 507 (Y507*)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably null
Transcript: ENSMUST00000053880
AA Change: Y507*
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y507*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111905
AA Change: Y507*
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y507*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Capn1 T C 19: 5,994,086 K535E probably benign Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Itpr3 A T 17: 27,096,063 Y728F probably damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Olfr794 A T 10: 129,571,311 I219F probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps13c G A 9: 67,881,422 V326M probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGATTAAATGTCCAACAAGCAC -3'
(R):5'- ATTGCTGAAAATCAGGCCAAC -3'

Sequencing Primer
(F):5'- TGTCCAACAAGCACTTCCTG -3'
(R):5'- TTGCTGAAAATCAGGCCAACAACAG -3'
Posted On2019-11-26