Incidental Mutation 'R7779:Camsap3'
ID 599080
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Name calmodulin regulated spectrin-associated protein family, member 3
Synonyms Nezha, 2310057J16Rik
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3637293-3659075 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3647887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 65 (Y65C)
Ref Sequence ENSEMBL: ENSMUSP00000146896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
AlphaFold Q80VC9
Predicted Effect probably damaging
Transcript: ENSMUST00000057028
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: Y65C

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171962
AA Change: Y65C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: Y65C

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207432
AA Change: Y65C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000207533
AA Change: Y65C
Predicted Effect unknown
Transcript: ENSMUST00000207712
AA Change: Y65C
Predicted Effect probably damaging
Transcript: ENSMUST00000207970
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208036
Predicted Effect unknown
Transcript: ENSMUST00000208240
AA Change: Y65C
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3,652,077 (GRCm39) missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3,652,115 (GRCm39) splice site probably benign
IGL01457:Camsap3 APN 8 3,654,795 (GRCm39) missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3,658,508 (GRCm39) missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3,653,845 (GRCm39) missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3,653,913 (GRCm39) missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3,654,288 (GRCm39) missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0347:Camsap3 UTSW 8 3,652,029 (GRCm39) missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R0946:Camsap3 UTSW 8 3,654,442 (GRCm39) missense probably benign 0.00
R1169:Camsap3 UTSW 8 3,653,866 (GRCm39) missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3,653,968 (GRCm39) missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R1820:Camsap3 UTSW 8 3,653,485 (GRCm39) missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3,653,922 (GRCm39) nonsense probably null
R1914:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3,654,789 (GRCm39) missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3,656,808 (GRCm39) missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3,656,515 (GRCm39) missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3,650,689 (GRCm39) missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3,654,244 (GRCm39) missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3,650,680 (GRCm39) missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3,653,812 (GRCm39) missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3,654,276 (GRCm39) missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3,647,899 (GRCm39) missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3,653,980 (GRCm39) missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3,651,999 (GRCm39) missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3,651,971 (GRCm39) missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3,653,941 (GRCm39) missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3,658,742 (GRCm39) missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3,654,186 (GRCm39) missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3,658,242 (GRCm39) missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3,657,834 (GRCm39) unclassified probably benign
R7109:Camsap3 UTSW 8 3,648,087 (GRCm39) missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3,650,371 (GRCm39) missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3,654,116 (GRCm39) missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3,654,648 (GRCm39) missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R7512:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R8134:Camsap3 UTSW 8 3,648,075 (GRCm39) missense probably benign 0.00
R8356:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8456:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8696:Camsap3 UTSW 8 3,653,614 (GRCm39) missense probably damaging 1.00
R8804:Camsap3 UTSW 8 3,652,624 (GRCm39) missense probably benign 0.14
R9022:Camsap3 UTSW 8 3,656,575 (GRCm39) missense probably benign 0.08
R9380:Camsap3 UTSW 8 3,653,999 (GRCm39) missense probably benign 0.09
R9706:Camsap3 UTSW 8 3,658,689 (GRCm39) missense possibly damaging 0.92
Z1192:Camsap3 UTSW 8 3,654,124 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGGCTTGTACCTATATG -3'
(R):5'- AGAGCCTACCATGAGAATTGGC -3'

Sequencing Primer
(F):5'- GTACCTATATGCCTGACTCTGTAG -3'
(R):5'- CCTACCATGAGAATTGGCTGGTG -3'
Posted On 2019-11-26