Incidental Mutation 'R7779:Arfgef3'
ID 599092
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, BIG3, D10Bwg1379e
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 18463759-18619506 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18470771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1665 (M1665V)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000019999
AA Change: M1665V

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: M1665V

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: M1665V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18,536,352 (GRCm39) missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18,537,106 (GRCm39) missense probably benign
IGL00961:Arfgef3 APN 10 18,486,985 (GRCm39) missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18,528,454 (GRCm39) missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18,476,308 (GRCm39) missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18,470,660 (GRCm39) missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18,479,167 (GRCm39) missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18,619,363 (GRCm39) missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18,467,095 (GRCm39) missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18,522,287 (GRCm39) missense probably benign
IGL02400:Arfgef3 APN 10 18,522,005 (GRCm39) missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18,537,140 (GRCm39) splice site probably benign
IGL02815:Arfgef3 APN 10 18,528,299 (GRCm39) missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18,488,973 (GRCm39) missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18,476,292 (GRCm39) missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18,467,630 (GRCm39) missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18,540,660 (GRCm39) missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18,476,238 (GRCm39) missense probably damaging 1.00
Bow-wow UTSW 10 18,522,478 (GRCm39) nonsense probably null
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18,465,390 (GRCm39) missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18,473,155 (GRCm39) missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18,523,663 (GRCm39) missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18,474,962 (GRCm39) missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18,468,029 (GRCm39) missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18,488,875 (GRCm39) splice site probably benign
R0417:Arfgef3 UTSW 10 18,479,259 (GRCm39) missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18,553,563 (GRCm39) splice site probably benign
R0507:Arfgef3 UTSW 10 18,467,369 (GRCm39) missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18,475,036 (GRCm39) missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18,487,038 (GRCm39) missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18,473,179 (GRCm39) missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18,465,414 (GRCm39) missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18,465,483 (GRCm39) missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18,467,866 (GRCm39) missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18,467,123 (GRCm39) missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18,473,096 (GRCm39) missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18,522,302 (GRCm39) missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18,506,627 (GRCm39) missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18,488,970 (GRCm39) nonsense probably null
R1564:Arfgef3 UTSW 10 18,467,452 (GRCm39) missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18,500,896 (GRCm39) missense probably null 0.15
R1868:Arfgef3 UTSW 10 18,537,135 (GRCm39) missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18,473,104 (GRCm39) missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18,528,511 (GRCm39) missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18,467,993 (GRCm39) missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18,492,701 (GRCm39) missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18,473,535 (GRCm39) missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18,553,614 (GRCm39) missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18,468,025 (GRCm39) missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18,495,530 (GRCm39) missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18,500,912 (GRCm39) missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18,473,457 (GRCm39) missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18,483,423 (GRCm39) missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18,476,348 (GRCm39) missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18,484,091 (GRCm39) missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18,521,947 (GRCm39) missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18,510,603 (GRCm39) missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18,529,995 (GRCm39) missense probably benign
R4801:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18,467,654 (GRCm39) missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18,522,385 (GRCm39) missense probably benign
R4828:Arfgef3 UTSW 10 18,528,441 (GRCm39) missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18,483,479 (GRCm39) missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18,492,638 (GRCm39) missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18,467,934 (GRCm39) missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18,506,599 (GRCm39) missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18,465,454 (GRCm39) missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18,476,208 (GRCm39) missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18,486,985 (GRCm39) missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18,523,546 (GRCm39) splice site probably null
R5832:Arfgef3 UTSW 10 18,506,168 (GRCm39) missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6272:Arfgef3 UTSW 10 18,522,711 (GRCm39) missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18,528,589 (GRCm39) missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18,483,413 (GRCm39) nonsense probably null
R6495:Arfgef3 UTSW 10 18,486,950 (GRCm39) critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18,496,903 (GRCm39) missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18,470,767 (GRCm39) missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18,540,637 (GRCm39) critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18,522,478 (GRCm39) nonsense probably null
R6941:Arfgef3 UTSW 10 18,501,203 (GRCm39) missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18,522,187 (GRCm39) missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18,475,015 (GRCm39) missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18,522,210 (GRCm39) missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18,501,139 (GRCm39) missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18,506,583 (GRCm39) missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18,506,211 (GRCm39) missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18,522,007 (GRCm39) missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18,522,377 (GRCm39) missense probably benign
R7618:Arfgef3 UTSW 10 18,522,029 (GRCm39) missense probably damaging 1.00
R7851:Arfgef3 UTSW 10 18,468,034 (GRCm39) missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18,528,379 (GRCm39) missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18,486,951 (GRCm39) critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18,505,824 (GRCm39) missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18,465,477 (GRCm39) missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18,528,280 (GRCm39) critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18,479,278 (GRCm39) missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18,522,799 (GRCm39) missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18,528,491 (GRCm39) missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18,511,453 (GRCm39) missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18,479,203 (GRCm39) missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18,522,476 (GRCm39) missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18,500,899 (GRCm39) missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18,465,387 (GRCm39) missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18,475,028 (GRCm39) missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18,492,628 (GRCm39) missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18,505,877 (GRCm39) missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18,479,271 (GRCm39) missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18,522,275 (GRCm39) missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18,528,556 (GRCm39) missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18,528,374 (GRCm39) missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18,510,600 (GRCm39) missense probably benign 0.26
Z1176:Arfgef3 UTSW 10 18,484,106 (GRCm39) missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18,467,185 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,503,376 (GRCm39) missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18,483,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGCCTAGCTAGAGTGTG -3'
(R):5'- TGAACTGACACGTGATAGAACAC -3'

Sequencing Primer
(F):5'- CCTAGCTAGAGTGTGGGAGTTG -3'
(R):5'- CTGACACGTGATAGAACACTAATAG -3'
Posted On 2019-11-26