Incidental Mutation 'R7779:Arid5b'
ID 599094
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67932606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1099 (Y1099H)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218532
AA Change: Y856H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: Y1099H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTACGGATGACAGCTGAG -3'
(R):5'- CTGGGAAAGAAAAGGCCTCC -3'

Sequencing Primer
(F):5'- CCTGAGGGTTGATACCAGCTAATG -3'
(R):5'- AAAAGGCCTCCGAACAGG -3'
Posted On 2019-11-26