Incidental Mutation 'R7779:Rai14'
ID 599114
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Name retinoic acid induced 14
Synonyms 1700020L11Rik, Ankycorbin, 1700008J19Rik, Norpeg
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 10569055-10714710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 10593112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 177 (D177E)
Ref Sequence ENSEMBL: ENSMUSP00000087815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
AlphaFold Q9EP71
Predicted Effect probably damaging
Transcript: ENSMUST00000090339
AA Change: D177E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: D177E

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169385
AA Change: D177E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: D177E

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: D177E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Itpr3 A T 17: 27,315,037 (GRCm39) Y728F probably damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10,599,797 (GRCm39) splice site probably benign
IGL01625:Rai14 APN 15 10,572,460 (GRCm39) missense probably benign 0.30
IGL01925:Rai14 APN 15 10,595,948 (GRCm39) missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10,633,242 (GRCm39) missense probably benign 0.00
IGL02531:Rai14 APN 15 10,574,868 (GRCm39) missense probably damaging 1.00
IGL02748:Rai14 APN 15 10,589,421 (GRCm39) missense probably benign 0.14
IGL02945:Rai14 APN 15 10,574,795 (GRCm39) missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10,575,242 (GRCm39) missense probably damaging 1.00
R1400:Rai14 UTSW 15 10,571,634 (GRCm39) missense probably damaging 0.98
R1583:Rai14 UTSW 15 10,588,002 (GRCm39) missense probably damaging 1.00
R1686:Rai14 UTSW 15 10,592,282 (GRCm39) missense probably damaging 0.98
R1721:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1867:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1868:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1998:Rai14 UTSW 15 10,595,067 (GRCm39) splice site probably null
R2118:Rai14 UTSW 15 10,575,252 (GRCm39) missense probably benign 0.00
R3161:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10,592,298 (GRCm39) missense probably benign 0.30
R4611:Rai14 UTSW 15 10,592,224 (GRCm39) missense probably damaging 1.00
R4760:Rai14 UTSW 15 10,575,776 (GRCm39) missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10,572,556 (GRCm39) missense probably damaging 0.99
R5022:Rai14 UTSW 15 10,574,592 (GRCm39) missense probably damaging 0.96
R5110:Rai14 UTSW 15 10,690,496 (GRCm39) start gained probably benign
R5410:Rai14 UTSW 15 10,575,024 (GRCm39) missense probably damaging 1.00
R5643:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5644:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5681:Rai14 UTSW 15 10,575,206 (GRCm39) missense probably damaging 1.00
R5934:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably damaging 0.98
R6333:Rai14 UTSW 15 10,575,022 (GRCm39) nonsense probably null
R6338:Rai14 UTSW 15 10,575,062 (GRCm39) missense probably damaging 1.00
R6864:Rai14 UTSW 15 10,633,254 (GRCm39) missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10,589,401 (GRCm39) nonsense probably null
R7155:Rai14 UTSW 15 10,595,089 (GRCm39) missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10,571,622 (GRCm39) missense probably benign 0.02
R7574:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,574,914 (GRCm39) missense probably benign
R7597:Rai14 UTSW 15 10,574,937 (GRCm39) missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7946:Rai14 UTSW 15 10,574,287 (GRCm39) splice site probably null
R8171:Rai14 UTSW 15 10,633,249 (GRCm39) missense probably damaging 1.00
R8195:Rai14 UTSW 15 10,575,302 (GRCm39) missense probably benign
R8471:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably benign 0.01
R8485:Rai14 UTSW 15 10,575,122 (GRCm39) missense probably damaging 1.00
R9075:Rai14 UTSW 15 10,589,403 (GRCm39) missense probably damaging 1.00
R9287:Rai14 UTSW 15 10,592,204 (GRCm39) missense probably benign 0.14
R9502:Rai14 UTSW 15 10,587,947 (GRCm39) missense possibly damaging 0.50
R9603:Rai14 UTSW 15 10,595,116 (GRCm39) nonsense probably null
R9665:Rai14 UTSW 15 10,574,803 (GRCm39) missense probably damaging 1.00
R9767:Rai14 UTSW 15 10,610,127 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGCCCATGGAGATCTGG -3'
(R):5'- TCAAGTGTAATGGTGGCCC -3'

Sequencing Primer
(F):5'- CCTCAATTACCAGGAAGGTAG -3'
(R):5'- CCTAAGGGGGCCTAGAATATCAC -3'
Posted On 2019-11-26