Incidental Mutation 'R7779:Itpr3'
ID599119
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27096063 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 728 (Y728F)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure
Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: Y728F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Y728F

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Capn1 T C 19: 5,994,086 K535E probably benign Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
Grin2b A T 6: 135,778,794 Y507* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Olfr794 A T 10: 129,571,311 I219F probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps13c G A 9: 67,881,422 V326M probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCTCCTGACATTGCTGCCAC -3'
(R):5'- AGTCAGTCAAATGGCTCAGC -3'

Sequencing Primer
(F):5'- CAGCATCGAGTACTCAGA -3'
(R):5'- GCCAGTAAAGGGCGTTTGC -3'
Posted On2019-11-26