Incidental Mutation 'R7779:Itpr3'
ID 599119
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms Itpr-3, Ip3r3, tf
MMRRC Submission 045835-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7779 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27276278-27341197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27315037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 728 (Y728F)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: Y728F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Y728F

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Meta Mutation Damage Score 0.6390 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,101,316 (GRCm39) V563E probably damaging Het
Adra1d A G 2: 131,403,805 (GRCm39) V95A probably damaging Het
Ak7 A C 12: 105,708,609 (GRCm39) I355L probably benign Het
Ank1 G A 8: 23,586,763 (GRCm39) probably null Het
Apol7c A T 15: 77,409,946 (GRCm39) H333Q probably damaging Het
Arfgef3 T C 10: 18,470,771 (GRCm39) M1665V probably damaging Het
Arid5b A G 10: 67,932,606 (GRCm39) Y1099H probably damaging Het
Atp8b1 A G 18: 64,674,453 (GRCm39) S943P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bco1 A G 8: 117,844,135 (GRCm39) Y283C probably damaging Het
Brd4 A T 17: 32,431,910 (GRCm39) D652E probably benign Het
Cacna1s G A 1: 136,046,767 (GRCm39) A1799T probably damaging Het
Camsap3 A G 8: 3,647,887 (GRCm39) Y65C probably damaging Het
Capn1 T C 19: 6,044,116 (GRCm39) K535E probably benign Het
Cbl A G 9: 44,070,393 (GRCm39) S480P probably benign Het
Cfap99 A C 5: 34,469,008 (GRCm39) N294T probably benign Het
Defa24 A C 8: 22,225,355 (GRCm39) S82R probably benign Het
Dnai2 T C 11: 114,645,235 (GRCm39) F557L possibly damaging Het
Dnhd1 T A 7: 105,327,122 (GRCm39) H690Q probably benign Het
Dock2 A G 11: 34,605,282 (GRCm39) V279A probably benign Het
Dst T A 1: 34,233,678 (GRCm39) V3462E probably damaging Het
E2f3 T G 13: 30,102,598 (GRCm39) H221P probably damaging Het
Eif2b4 A T 5: 31,347,998 (GRCm39) I238N probably damaging Het
Eno4 T C 19: 58,956,975 (GRCm39) S530P probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Extl1 T C 4: 134,087,908 (GRCm39) K449E probably benign Het
F13b T A 1: 139,444,124 (GRCm39) V486E probably benign Het
Fbln2 T A 6: 91,210,176 (GRCm39) L40Q probably damaging Het
Glp2r C T 11: 67,600,609 (GRCm39) W413* probably null Het
Grin2b A T 6: 135,755,792 (GRCm39) Y507* probably null Het
H2-M11 G T 17: 36,859,698 (GRCm39) L230F probably benign Het
Il36a T C 2: 24,106,613 (GRCm39) Y66H probably damaging Het
Itpr1 A G 6: 108,500,309 (GRCm39) E2634G possibly damaging Het
Jak1 C T 4: 101,017,339 (GRCm39) E764K probably benign Het
Jak3 G T 8: 72,139,932 (GRCm39) R1045L probably benign Het
Jam2 T C 16: 84,606,271 (GRCm39) I95T probably damaging Het
Kdf1 T C 4: 133,255,796 (GRCm39) V171A probably damaging Het
Lactbl1 A T 4: 136,358,307 (GRCm39) K93* probably null Het
Lcn6 T C 2: 25,570,805 (GRCm39) V131A probably benign Het
Lpar5 T A 6: 125,059,207 (GRCm39) D309E probably damaging Het
Lrfn4 T C 19: 4,663,715 (GRCm39) E273G probably damaging Het
Lta4h C T 10: 93,310,811 (GRCm39) T447I probably benign Het
Lyst A G 13: 13,809,128 (GRCm39) E266G probably damaging Het
Mab21l1 A T 3: 55,690,796 (GRCm39) I128F possibly damaging Het
Mrgprb4 T G 7: 47,848,895 (GRCm39) N11T probably benign Het
Mroh6 G A 15: 75,760,505 (GRCm39) T23I possibly damaging Het
Myo1f T C 17: 33,797,247 (GRCm39) I143T probably benign Het
Myof C T 19: 37,927,838 (GRCm39) D1092N probably damaging Het
Ncan G T 8: 70,567,661 (GRCm39) D150E probably damaging Het
Or1d2 T A 11: 74,255,771 (GRCm39) I92N probably damaging Het
Or2y1f T A 11: 49,185,048 (GRCm39) L300Q probably damaging Het
Or6c88 A T 10: 129,407,180 (GRCm39) I219F probably damaging Het
Pcm1 A G 8: 41,782,061 (GRCm39) Y1948C probably damaging Het
Pcsk6 A T 7: 65,675,152 (GRCm39) T669S probably benign Het
Pdlim5 A C 3: 141,948,447 (GRCm39) N613K probably benign Het
Pdzk1 T A 3: 96,764,589 (GRCm39) V291D probably damaging Het
Plbd2 T C 5: 120,625,743 (GRCm39) Q408R probably damaging Het
Ppp1r37 C A 7: 19,266,712 (GRCm39) A392S possibly damaging Het
Proser2 T A 2: 6,107,878 (GRCm39) probably null Het
Psmd12 T C 11: 107,388,405 (GRCm39) V406A probably benign Het
Rab3gap2 T C 1: 184,991,641 (GRCm39) V709A probably damaging Het
Radil T C 5: 142,473,320 (GRCm39) E787G probably benign Het
Rai14 A C 15: 10,593,112 (GRCm39) D177E probably damaging Het
Rbms2 G A 10: 127,979,315 (GRCm39) T166I probably damaging Het
Rrh C T 3: 129,608,969 (GRCm39) C115Y probably benign Het
Slc1a6 C T 10: 78,631,789 (GRCm39) T205I probably damaging Het
Sost T C 11: 101,857,675 (GRCm39) E42G possibly damaging Het
Spcs3 T A 8: 54,982,805 (GRCm39) I46F possibly damaging Het
Spg11 A G 2: 121,901,420 (GRCm39) S1507P probably damaging Het
Sprtn C T 8: 125,624,982 (GRCm39) P29L possibly damaging Het
Sptan1 C T 2: 29,911,319 (GRCm39) T1886I probably damaging Het
Strn4 T C 7: 16,565,417 (GRCm39) F394S probably damaging Het
Syt14 A T 1: 192,666,751 (GRCm39) M51K unknown Het
Terb2 A G 2: 122,016,975 (GRCm39) K32R probably benign Het
Tex15 G A 8: 34,065,309 (GRCm39) G1580R probably damaging Het
Thumpd3 T C 6: 113,036,950 (GRCm39) V283A probably damaging Het
Tm7sf2 T C 19: 6,112,947 (GRCm39) Y418C possibly damaging Het
Trim24 T G 6: 37,896,332 (GRCm39) F263C probably damaging Het
Trim24 T A 6: 37,896,333 (GRCm39) F263L probably damaging Het
Trip11 A G 12: 101,849,796 (GRCm39) S1423P probably damaging Het
Vps13c G A 9: 67,788,704 (GRCm39) V326M probably damaging Het
Vps37c T C 19: 10,689,988 (GRCm39) V150A probably damaging Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Wfdc9 A G 2: 164,492,516 (GRCm39) V37A probably damaging Het
Yif1b T A 7: 28,945,328 (GRCm39) M227K probably damaging Het
Zbtb18 T C 1: 177,274,505 (GRCm39) probably benign Het
Zfp318 A G 17: 46,710,820 (GRCm39) T848A probably benign Het
Zfp808 T A 13: 62,320,571 (GRCm39) I600K possibly damaging Het
Zmym1 C A 4: 126,948,038 (GRCm39) S111I probably benign Het
Zmym2 A G 14: 57,165,740 (GRCm39) T688A probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27,302,603 (GRCm39) missense probably benign 0.05
IGL00980:Itpr3 APN 17 27,329,930 (GRCm39) missense probably benign
IGL01151:Itpr3 APN 17 27,310,503 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27,318,739 (GRCm39) missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27,337,569 (GRCm39) missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27,336,152 (GRCm39) missense probably benign 0.02
IGL01897:Itpr3 APN 17 27,330,236 (GRCm39) missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27,340,449 (GRCm39) missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27,323,069 (GRCm39) missense probably benign
IGL02063:Itpr3 APN 17 27,338,997 (GRCm39) missense probably benign 0.01
IGL02146:Itpr3 APN 17 27,336,249 (GRCm39) missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27,317,416 (GRCm39) missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27,318,588 (GRCm39) missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27,317,153 (GRCm39) missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27,333,486 (GRCm39) splice site probably benign
IGL02651:Itpr3 APN 17 27,325,372 (GRCm39) missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27,323,530 (GRCm39) missense probably benign 0.21
IGL03001:Itpr3 APN 17 27,308,586 (GRCm39) splice site probably benign
IGL03004:Itpr3 APN 17 27,316,952 (GRCm39) missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27,310,907 (GRCm39) missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27,338,240 (GRCm39) missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27,330,242 (GRCm39) missense probably benign
IGL03404:Itpr3 APN 17 27,310,492 (GRCm39) missense probably damaging 1.00
Allure UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
alopecia UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Beauty UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
Opuesto UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
Paradox UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
Pulchritude UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27,339,951 (GRCm39) missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27,317,296 (GRCm39) missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0104:Itpr3 UTSW 17 27,314,966 (GRCm39) missense probably benign 0.01
R0195:Itpr3 UTSW 17 27,333,088 (GRCm39) missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27,308,293 (GRCm39) missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27,332,793 (GRCm39) missense probably benign
R0485:Itpr3 UTSW 17 27,330,903 (GRCm39) missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27,326,263 (GRCm39) missense probably benign 0.09
R0781:Itpr3 UTSW 17 27,329,529 (GRCm39) missense probably benign 0.00
R0890:Itpr3 UTSW 17 27,307,985 (GRCm39) nonsense probably null
R1028:Itpr3 UTSW 17 27,310,343 (GRCm39) missense probably benign 0.04
R1144:Itpr3 UTSW 17 27,333,897 (GRCm39) missense probably benign 0.01
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1458:Itpr3 UTSW 17 27,337,346 (GRCm39) missense probably benign 0.01
R1463:Itpr3 UTSW 17 27,336,128 (GRCm39) splice site probably benign
R1472:Itpr3 UTSW 17 27,333,199 (GRCm39) missense probably benign 0.09
R1529:Itpr3 UTSW 17 27,324,459 (GRCm39) splice site probably null
R1533:Itpr3 UTSW 17 27,314,534 (GRCm39) missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27,333,121 (GRCm39) missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27,335,581 (GRCm39) critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27,307,987 (GRCm39) missense probably benign
R1726:Itpr3 UTSW 17 27,330,664 (GRCm39) missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27,338,997 (GRCm39) missense probably benign 0.01
R1940:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27,321,785 (GRCm39) missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2064:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2065:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2067:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2068:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2219:Itpr3 UTSW 17 27,334,027 (GRCm39) missense probably benign
R2248:Itpr3 UTSW 17 27,334,033 (GRCm39) missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27,332,553 (GRCm39) missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27,314,889 (GRCm39) missense probably benign
R2864:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R2865:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R3778:Itpr3 UTSW 17 27,314,446 (GRCm39) missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27,332,814 (GRCm39) missense probably benign 0.01
R3979:Itpr3 UTSW 17 27,310,546 (GRCm39) missense probably damaging 1.00
R3979:Itpr3 UTSW 17 27,304,105 (GRCm39) missense probably benign 0.23
R4224:Itpr3 UTSW 17 27,326,232 (GRCm39) missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27,325,298 (GRCm39) missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27,330,948 (GRCm39) missense probably benign 0.00
R4466:Itpr3 UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27,323,586 (GRCm39) missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27,312,257 (GRCm39) missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27,304,121 (GRCm39) missense probably benign 0.30
R4921:Itpr3 UTSW 17 27,316,979 (GRCm39) missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27,302,582 (GRCm39) missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27,308,885 (GRCm39) missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27,317,397 (GRCm39) missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27,335,663 (GRCm39) missense probably benign 0.38
R5518:Itpr3 UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27,326,308 (GRCm39) missense probably benign 0.09
R5566:Itpr3 UTSW 17 27,334,926 (GRCm39) missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27,322,880 (GRCm39) missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27,332,493 (GRCm39) missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27,337,540 (GRCm39) missense probably benign 0.42
R5658:Itpr3 UTSW 17 27,326,852 (GRCm39) missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27,325,379 (GRCm39) missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27,305,950 (GRCm39) missense probably benign 0.02
R5878:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R5889:Itpr3 UTSW 17 27,334,039 (GRCm39) missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27,336,867 (GRCm39) missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27,329,895 (GRCm39) missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27,323,575 (GRCm39) missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27,330,174 (GRCm39) missense probably benign 0.03
R6233:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27,314,449 (GRCm39) missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6515:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6516:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6955:Itpr3 UTSW 17 27,340,441 (GRCm39) missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27,329,554 (GRCm39) missense probably benign 0.00
R7064:Itpr3 UTSW 17 27,308,269 (GRCm39) missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27,337,535 (GRCm39) missense probably benign 0.00
R7349:Itpr3 UTSW 17 27,326,786 (GRCm39) splice site probably null
R7469:Itpr3 UTSW 17 27,340,028 (GRCm39) missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27,313,774 (GRCm39) missense probably benign 0.09
R7510:Itpr3 UTSW 17 27,308,013 (GRCm39) missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27,329,862 (GRCm39) missense probably benign 0.01
R7616:Itpr3 UTSW 17 27,307,951 (GRCm39) missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27,317,088 (GRCm39) missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27,337,571 (GRCm39) nonsense probably null
R7871:Itpr3 UTSW 17 27,336,153 (GRCm39) missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27,335,751 (GRCm39) missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27,331,002 (GRCm39) critical splice donor site probably null
R8065:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8067:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8230:Itpr3 UTSW 17 27,326,711 (GRCm39) critical splice donor site probably null
R8263:Itpr3 UTSW 17 27,334,887 (GRCm39) nonsense probably null
R8264:Itpr3 UTSW 17 27,323,086 (GRCm39) synonymous silent
R8269:Itpr3 UTSW 17 27,312,258 (GRCm39) missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27,306,622 (GRCm39) missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27,325,199 (GRCm39) missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27,334,893 (GRCm39) missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27,330,900 (GRCm39) missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8679:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8846:Itpr3 UTSW 17 27,330,996 (GRCm39) missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8885:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8886:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8887:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8888:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8891:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8896:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8975:Itpr3 UTSW 17 27,335,628 (GRCm39) missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9026:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9063:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9087:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9088:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9089:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9090:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9091:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9200:Itpr3 UTSW 17 27,326,636 (GRCm39) missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9271:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9294:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27,314,899 (GRCm39) missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9434:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9443:Itpr3 UTSW 17 27,324,523 (GRCm39) missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9474:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9475:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9476:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9477:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9507:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9508:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9511:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9694:Itpr3 UTSW 17 27,334,927 (GRCm39) missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27,308,915 (GRCm39) missense probably benign 0.15
V7732:Itpr3 UTSW 17 27,330,000 (GRCm39) splice site probably null
V7732:Itpr3 UTSW 17 27,329,998 (GRCm39) splice site probably benign
Z1088:Itpr3 UTSW 17 27,332,502 (GRCm39) missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27,338,961 (GRCm39) missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27,333,903 (GRCm39) missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCTCCTGACATTGCTGCCAC -3'
(R):5'- AGTCAGTCAAATGGCTCAGC -3'

Sequencing Primer
(F):5'- CAGCATCGAGTACTCAGA -3'
(R):5'- GCCAGTAAAGGGCGTTTGC -3'
Posted On 2019-11-26