Incidental Mutation 'R7780:Olfr830'
ID599170
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Nameolfactory receptor 830
SynonymsGA_x6K02T2PVTD-12618399-12619337, MOR152-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7780 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18874693-18878369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18875614 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 93 (T93A)
Ref Sequence ENSEMBL: ENSMUSP00000148394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078861
AA Change: T96A

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: T96A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212723
AA Change: T93A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,372 S495P probably damaging Het
Adam5 C T 8: 24,804,416 R389K possibly damaging Het
Ahnak2 C T 12: 112,782,613 V1205M Het
C330027C09Rik T A 16: 49,001,660 L217* probably null Het
Ccr3 A G 9: 124,028,952 Y108C probably benign Het
Cers5 T G 15: 99,739,708 H220P probably damaging Het
Cfap61 A T 2: 146,153,772 N1086Y possibly damaging Het
Clstn3 T C 6: 124,462,202 E32G probably damaging Het
Cox20 T C 1: 178,322,001 C72R probably benign Het
Csf1 A T 3: 107,750,393 N154K probably damaging Het
Cyp2j7 T A 4: 96,230,019 K112N probably benign Het
Dpcr1 A G 17: 35,636,982 S452P possibly damaging Het
Drosha A G 15: 12,848,086 D488G probably benign Het
Edem1 A G 6: 108,841,628 K199R probably benign Het
Esyt2 T C 12: 116,342,098 I316T probably benign Het
Evpl C T 11: 116,234,174 R154H not run Het
Fam198b G A 3: 79,941,404 G486S probably damaging Het
Fbn1 A G 2: 125,301,758 L2817P probably benign Het
Fbxo42 T A 4: 141,193,820 probably null Het
Fbxo43 T C 15: 36,162,212 D283G probably damaging Het
Fdxr A T 11: 115,276,830 S20T probably benign Het
Fkbp10 T C 11: 100,421,222 Y203H probably damaging Het
Galntl6 C T 8: 58,427,699 probably null Het
Gm26657 C A 4: 56,741,056 Y80* probably null Het
Gm973 T A 1: 59,558,130 W440R probably damaging Het
Helz T A 11: 107,637,863 F903Y probably damaging Het
Iqcf4 T A 9: 106,568,661 I96F possibly damaging Het
Kcnq5 T A 1: 21,961,331 Q84L probably benign Het
Krit1 G A 5: 3,812,772 G254S probably damaging Het
Krtap6-2 A T 16: 89,419,622 Y152* probably null Het
Lor A T 3: 92,081,153 Y275* probably null Het
Map4 T C 9: 110,034,652 I315T probably benign Het
Mcpt1 T A 14: 56,019,152 probably null Het
Mdh1b C A 1: 63,719,974 S153I possibly damaging Het
Mfsd12 C A 10: 81,357,884 A96E probably benign Het
Mki67 T C 7: 135,713,968 E55G probably benign Het
Mterf4 T C 1: 93,304,967 E54G probably benign Het
Nuggc T A 14: 65,645,041 I745N probably damaging Het
Olfr231 T C 1: 174,117,549 I156V probably benign Het
Parg A T 14: 32,208,801 N126I possibly damaging Het
Pcdh9 T C 14: 93,886,551 I728V possibly damaging Het
Pcdha1 C G 18: 36,932,458 P725R probably benign Het
Pcdha11 T A 18: 37,012,796 L647M probably damaging Het
Phb2 T C 6: 124,716,032 probably null Het
Plb1 A G 5: 32,326,266 probably null Het
Pmch T A 10: 88,091,251 F39I probably benign Het
Psmd7 A T 8: 107,581,288 S188T possibly damaging Het
Pycr2 T A 1: 180,906,348 D168E probably damaging Het
Rab43 A G 6: 87,794,710 Y96H probably damaging Het
Ralgapa2 C T 2: 146,342,414 G1511S probably benign Het
Rb1cc1 T A 1: 6,248,914 C852* probably null Het
Rexo2 T C 9: 48,468,845 N229S probably damaging Het
Sema4f A G 6: 82,913,960 V622A possibly damaging Het
Serpina10 T C 12: 103,628,547 S138G probably benign Het
Sptbn4 T A 7: 27,361,634 T2415S possibly damaging Het
Tbc1d22b A G 17: 29,573,066 N257D probably benign Het
Tbl3 A G 17: 24,702,231 F529L probably damaging Het
Them6 A T 15: 74,721,578 N95I probably benign Het
Thrb T C 14: 18,008,608 S156P possibly damaging Het
Tmem186 G A 16: 8,635,867 R177C probably benign Het
Ttn T A 2: 76,830,593 probably null Het
Unc13a T A 8: 71,658,335 I411F probably benign Het
Uqcc1 T C 2: 155,910,153 probably null Het
Vmn1r56 T C 7: 5,196,517 T34A possibly damaging Het
Vps39 A T 2: 120,325,199 Y542* probably null Het
Wdr64 T C 1: 175,728,976 L263P probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc16 A G 2: 164,635,865 M88T probably benign Het
Wnk4 A G 11: 101,269,577 D679G probably damaging Het
Ykt6 T C 11: 5,962,751 I151T probably benign Het
Zbtb46 A G 2: 181,391,432 C479R probably damaging Het
Zc3h7a A G 16: 11,149,251 I559T probably benign Het
Zfhx3 A G 8: 108,951,651 N3111S possibly damaging Het
Zfp619 T C 7: 39,535,008 V154A possibly damaging Het
Zfp629 A T 7: 127,612,429 D69E probably benign Het
Zfp882 T A 8: 71,914,229 I300N possibly damaging Het
Zfp934 T C 13: 62,518,544 H106R possibly damaging Het
Zfyve9 G A 4: 108,719,101 T261I possibly damaging Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1322:Olfr830 UTSW 9 18875521 missense possibly damaging 0.90
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R1803:Olfr830 UTSW 9 18876080 missense probably damaging 1.00
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4394:Olfr830 UTSW 9 18875611 missense probably damaging 0.98
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6602:Olfr830 UTSW 9 18875849 missense possibly damaging 0.81
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R8245:Olfr830 UTSW 9 18875830 missense probably benign
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGCAGCCATTCATC -3'
(R):5'- TGCAGCAGACCATTTACAATAC -3'

Sequencing Primer
(F):5'- AAGCATATACTTGATTACCGTTTCTG -3'
(R):5'- GCAGCAGACCATTTACAATACTAAAG -3'
Posted On2019-11-26