Incidental Mutation 'R7780:Helz'
ID599180
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7780 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107637863 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 903 (F903Y)
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: F903Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: F903Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: F902Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: F902Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: F902Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: F902Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: F221Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: F221Y

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,372 S495P probably damaging Het
Adam5 C T 8: 24,804,416 R389K possibly damaging Het
Ahnak2 C T 12: 112,782,613 V1205M Het
C330027C09Rik T A 16: 49,001,660 L217* probably null Het
Ccr3 A G 9: 124,028,952 Y108C probably benign Het
Cers5 T G 15: 99,739,708 H220P probably damaging Het
Cfap61 A T 2: 146,153,772 N1086Y possibly damaging Het
Clstn3 T C 6: 124,462,202 E32G probably damaging Het
Cox20 T C 1: 178,322,001 C72R probably benign Het
Csf1 A T 3: 107,750,393 N154K probably damaging Het
Cyp2j7 T A 4: 96,230,019 K112N probably benign Het
Dpcr1 A G 17: 35,636,982 S452P possibly damaging Het
Drosha A G 15: 12,848,086 D488G probably benign Het
Edem1 A G 6: 108,841,628 K199R probably benign Het
Esyt2 T C 12: 116,342,098 I316T probably benign Het
Evpl C T 11: 116,234,174 R154H not run Het
Fam198b G A 3: 79,941,404 G486S probably damaging Het
Fbn1 A G 2: 125,301,758 L2817P probably benign Het
Fbxo42 T A 4: 141,193,820 probably null Het
Fbxo43 T C 15: 36,162,212 D283G probably damaging Het
Fdxr A T 11: 115,276,830 S20T probably benign Het
Fkbp10 T C 11: 100,421,222 Y203H probably damaging Het
Galntl6 C T 8: 58,427,699 probably null Het
Gm26657 C A 4: 56,741,056 Y80* probably null Het
Gm973 T A 1: 59,558,130 W440R probably damaging Het
Iqcf4 T A 9: 106,568,661 I96F possibly damaging Het
Kcnq5 T A 1: 21,961,331 Q84L probably benign Het
Krit1 G A 5: 3,812,772 G254S probably damaging Het
Krtap6-2 A T 16: 89,419,622 Y152* probably null Het
Lor A T 3: 92,081,153 Y275* probably null Het
Map4 T C 9: 110,034,652 I315T probably benign Het
Mcpt1 T A 14: 56,019,152 probably null Het
Mdh1b C A 1: 63,719,974 S153I possibly damaging Het
Mfsd12 C A 10: 81,357,884 A96E probably benign Het
Mki67 T C 7: 135,713,968 E55G probably benign Het
Mterf4 T C 1: 93,304,967 E54G probably benign Het
Nuggc T A 14: 65,645,041 I745N probably damaging Het
Olfr231 T C 1: 174,117,549 I156V probably benign Het
Olfr830 A G 9: 18,875,614 T93A possibly damaging Het
Parg A T 14: 32,208,801 N126I possibly damaging Het
Pcdh9 T C 14: 93,886,551 I728V possibly damaging Het
Pcdha1 C G 18: 36,932,458 P725R probably benign Het
Pcdha11 T A 18: 37,012,796 L647M probably damaging Het
Phb2 T C 6: 124,716,032 probably null Het
Plb1 A G 5: 32,326,266 probably null Het
Pmch T A 10: 88,091,251 F39I probably benign Het
Psmd7 A T 8: 107,581,288 S188T possibly damaging Het
Pycr2 T A 1: 180,906,348 D168E probably damaging Het
Rab43 A G 6: 87,794,710 Y96H probably damaging Het
Ralgapa2 C T 2: 146,342,414 G1511S probably benign Het
Rb1cc1 T A 1: 6,248,914 C852* probably null Het
Rexo2 T C 9: 48,468,845 N229S probably damaging Het
Sema4f A G 6: 82,913,960 V622A possibly damaging Het
Serpina10 T C 12: 103,628,547 S138G probably benign Het
Sptbn4 T A 7: 27,361,634 T2415S possibly damaging Het
Tbc1d22b A G 17: 29,573,066 N257D probably benign Het
Tbl3 A G 17: 24,702,231 F529L probably damaging Het
Them6 A T 15: 74,721,578 N95I probably benign Het
Thrb T C 14: 18,008,608 S156P possibly damaging Het
Tmem186 G A 16: 8,635,867 R177C probably benign Het
Ttn T A 2: 76,830,593 probably null Het
Unc13a T A 8: 71,658,335 I411F probably benign Het
Uqcc1 T C 2: 155,910,153 probably null Het
Vmn1r56 T C 7: 5,196,517 T34A possibly damaging Het
Vps39 A T 2: 120,325,199 Y542* probably null Het
Wdr64 T C 1: 175,728,976 L263P probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc16 A G 2: 164,635,865 M88T probably benign Het
Wnk4 A G 11: 101,269,577 D679G probably damaging Het
Ykt6 T C 11: 5,962,751 I151T probably benign Het
Zbtb46 A G 2: 181,391,432 C479R probably damaging Het
Zc3h7a A G 16: 11,149,251 I559T probably benign Het
Zfhx3 A G 8: 108,951,651 N3111S possibly damaging Het
Zfp619 T C 7: 39,535,008 V154A possibly damaging Het
Zfp629 A T 7: 127,612,429 D69E probably benign Het
Zfp882 T A 8: 71,914,229 I300N possibly damaging Het
Zfp934 T C 13: 62,518,544 H106R possibly damaging Het
Zfyve9 G A 4: 108,719,101 T261I possibly damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R8024:Helz UTSW 11 107686421 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCGTCACAGGTATTCAGTG -3'
(R):5'- CGTTGGCTTTTCTTAACAAAGTTGC -3'

Sequencing Primer
(F):5'- CACAGGTATTCAGTGTTGGGAC -3'
(R):5'- GTTGCATTTTCTGTTTTAACATTGC -3'
Posted On2019-11-26