Incidental Mutation 'R7780:Helz'
ID599180
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7780 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107637863 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 903 (F903Y)
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: F903Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: F903Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: F902Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: F902Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: F902Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: F902Y

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: F221Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: F221Y

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,372 S495P probably damaging Het
Adam5 C T 8: 24,804,416 R389K possibly damaging Het
Ahnak2 C T 12: 112,782,613 V1205M Het
C330027C09Rik T A 16: 49,001,660 L217* probably null Het
Ccr3 A G 9: 124,028,952 Y108C probably benign Het
Cers5 T G 15: 99,739,708 H220P probably damaging Het
Cfap61 A T 2: 146,153,772 N1086Y possibly damaging Het
Clstn3 T C 6: 124,462,202 E32G probably damaging Het
Cox20 T C 1: 178,322,001 C72R probably benign Het
Csf1 A T 3: 107,750,393 N154K probably damaging Het
Cyp2j7 T A 4: 96,230,019 K112N probably benign Het
Dpcr1 A G 17: 35,636,982 S452P possibly damaging Het
Drosha A G 15: 12,848,086 D488G probably benign Het
Edem1 A G 6: 108,841,628 K199R probably benign Het
Esyt2 T C 12: 116,342,098 I316T probably benign Het
Evpl C T 11: 116,234,174 R154H not run Het
Fam198b G A 3: 79,941,404 G486S probably damaging Het
Fbn1 A G 2: 125,301,758 L2817P probably benign Het
Fbxo42 T A 4: 141,193,820 probably null Het
Fbxo43 T C 15: 36,162,212 D283G probably damaging Het
Fdxr A T 11: 115,276,830 S20T probably benign Het
Fkbp10 T C 11: 100,421,222 Y203H probably damaging Het
Galntl6 C T 8: 58,427,699 probably null Het
Gm26657 C A 4: 56,741,056 Y80* probably null Het
Gm973 T A 1: 59,558,130 W440R probably damaging Het
Iqcf4 T A 9: 106,568,661 I96F possibly damaging Het
Kcnq5 T A 1: 21,961,331 Q84L probably benign Het
Krit1 G A 5: 3,812,772 G254S probably damaging Het
Krtap6-2 A T 16: 89,419,622 Y152* probably null Het
Lor A T 3: 92,081,153 Y275* probably null Het
Map4 T C 9: 110,034,652 I315T probably benign Het
Mcpt1 T A 14: 56,019,152 probably null Het
Mdh1b C A 1: 63,719,974 S153I possibly damaging Het
Mfsd12 C A 10: 81,357,884 A96E probably benign Het
Mki67 T C 7: 135,713,968 E55G probably benign Het
Mterf4 T C 1: 93,304,967 E54G probably benign Het
Nuggc T A 14: 65,645,041 I745N probably damaging Het
Olfr231 T C 1: 174,117,549 I156V probably benign Het
Olfr830 A G 9: 18,875,614 T93A possibly damaging Het
Parg A T 14: 32,208,801 N126I possibly damaging Het
Pcdh9 T C 14: 93,886,551 I728V possibly damaging Het
Pcdha1 C G 18: 36,932,458 P725R probably benign Het
Pcdha11 T A 18: 37,012,796 L647M probably damaging Het
Phb2 T C 6: 124,716,032 probably null Het
Plb1 A G 5: 32,326,266 probably null Het
Pmch T A 10: 88,091,251 F39I probably benign Het
Psmd7 A T 8: 107,581,288 S188T possibly damaging Het
Pycr2 T A 1: 180,906,348 D168E probably damaging Het
Rab43 A G 6: 87,794,710 Y96H probably damaging Het
Ralgapa2 C T 2: 146,342,414 G1511S probably benign Het
Rb1cc1 T A 1: 6,248,914 C852* probably null Het
Rexo2 T C 9: 48,468,845 N229S probably damaging Het
Sema4f A G 6: 82,913,960 V622A possibly damaging Het
Serpina10 T C 12: 103,628,547 S138G probably benign Het
Sptbn4 T A 7: 27,361,634 T2415S possibly damaging Het
Tbc1d22b A G 17: 29,573,066 N257D probably benign Het
Tbl3 A G 17: 24,702,231 F529L probably damaging Het
Them6 A T 15: 74,721,578 N95I probably benign Het
Thrb T C 14: 18,008,608 S156P possibly damaging Het
Tmem186 G A 16: 8,635,867 R177C probably benign Het
Ttn T A 2: 76,830,593 probably null Het
Unc13a T A 8: 71,658,335 I411F probably benign Het
Uqcc1 T C 2: 155,910,153 probably null Het
Vmn1r56 T C 7: 5,196,517 T34A possibly damaging Het
Vps39 A T 2: 120,325,199 Y542* probably null Het
Wdr64 T C 1: 175,728,976 L263P probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc16 A G 2: 164,635,865 M88T probably benign Het
Wnk4 A G 11: 101,269,577 D679G probably damaging Het
Ykt6 T C 11: 5,962,751 I151T probably benign Het
Zbtb46 A G 2: 181,391,432 C479R probably damaging Het
Zc3h7a A G 16: 11,149,251 I559T probably benign Het
Zfhx3 A G 8: 108,951,651 N3111S possibly damaging Het
Zfp619 T C 7: 39,535,008 V154A possibly damaging Het
Zfp629 A T 7: 127,612,429 D69E probably benign Het
Zfp882 T A 8: 71,914,229 I300N possibly damaging Het
Zfp934 T C 13: 62,518,544 H106R possibly damaging Het
Zfyve9 G A 4: 108,719,101 T261I possibly damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8729:Helz UTSW 11 107637928 critical splice donor site probably null
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8821:Helz UTSW 11 107635093 missense probably damaging 0.99
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCGTCACAGGTATTCAGTG -3'
(R):5'- CGTTGGCTTTTCTTAACAAAGTTGC -3'

Sequencing Primer
(F):5'- CACAGGTATTCAGTGTTGGGAC -3'
(R):5'- GTTGCATTTTCTGTTTTAACATTGC -3'
Posted On2019-11-26