Incidental Mutation 'R7780:Tbc1d22b'
ID 599202
Institutional Source Beutler Lab
Gene Symbol Tbc1d22b
Ensembl Gene ENSMUSG00000042203
Gene Name TBC1 domain family, member 22B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7780 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29549788-29606895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29573066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 257 (N257D)
Ref Sequence ENSEMBL: ENSMUSP00000046877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048677]
AlphaFold Q80VE5
Predicted Effect probably benign
Transcript: ENSMUST00000048677
AA Change: N257D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046877
Gene: ENSMUSG00000042203
AA Change: N257D

DomainStartEndE-ValueType
Blast:TBC 23 93 6e-12 BLAST
TBC 207 460 1.25e-56 SMART
Blast:TBC 464 504 4e-18 BLAST
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,372 S495P probably damaging Het
Adam5 C T 8: 24,804,416 R389K possibly damaging Het
Ahnak2 C T 12: 112,782,613 V1205M Het
C330027C09Rik T A 16: 49,001,660 L217* probably null Het
Ccr3 A G 9: 124,028,952 Y108C probably benign Het
Cers5 T G 15: 99,739,708 H220P probably damaging Het
Cfap61 A T 2: 146,153,772 N1086Y possibly damaging Het
Clstn3 T C 6: 124,462,202 E32G probably damaging Het
Cox20 T C 1: 178,322,001 C72R probably benign Het
Csf1 A T 3: 107,750,393 N154K probably damaging Het
Cyp2j7 T A 4: 96,230,019 K112N probably benign Het
Dpcr1 A G 17: 35,636,982 S452P possibly damaging Het
Drosha A G 15: 12,848,086 D488G probably benign Het
Edem1 A G 6: 108,841,628 K199R probably benign Het
Esyt2 T C 12: 116,342,098 I316T probably benign Het
Evpl C T 11: 116,234,174 R154H not run Het
Fam198b G A 3: 79,941,404 G486S probably damaging Het
Fbn1 A G 2: 125,301,758 L2817P probably benign Het
Fbxo42 T A 4: 141,193,820 probably null Het
Fbxo43 T C 15: 36,162,212 D283G probably damaging Het
Fdxr A T 11: 115,276,830 S20T probably benign Het
Fkbp10 T C 11: 100,421,222 Y203H probably damaging Het
Galntl6 C T 8: 58,427,699 probably null Het
Gm26657 C A 4: 56,741,056 Y80* probably null Het
Gm973 T A 1: 59,558,130 W440R probably damaging Het
Helz T A 11: 107,637,863 F903Y probably damaging Het
Iqcf4 T A 9: 106,568,661 I96F possibly damaging Het
Kcnq5 T A 1: 21,961,331 Q84L probably benign Het
Krit1 G A 5: 3,812,772 G254S probably damaging Het
Krtap6-2 A T 16: 89,419,622 Y152* probably null Het
Lor A T 3: 92,081,153 Y275* probably null Het
Map4 T C 9: 110,034,652 I315T probably benign Het
Mcpt1 T A 14: 56,019,152 probably null Het
Mdh1b C A 1: 63,719,974 S153I possibly damaging Het
Mfsd12 C A 10: 81,357,884 A96E probably benign Het
Mki67 T C 7: 135,713,968 E55G probably benign Het
Mterf4 T C 1: 93,304,967 E54G probably benign Het
Nuggc T A 14: 65,645,041 I745N probably damaging Het
Olfr231 T C 1: 174,117,549 I156V probably benign Het
Olfr830 A G 9: 18,875,614 T93A possibly damaging Het
Parg A T 14: 32,208,801 N126I possibly damaging Het
Pcdh9 T C 14: 93,886,551 I728V possibly damaging Het
Pcdha1 C G 18: 36,932,458 P725R probably benign Het
Pcdha11 T A 18: 37,012,796 L647M probably damaging Het
Phb2 T C 6: 124,716,032 probably null Het
Plb1 A G 5: 32,326,266 probably null Het
Pmch T A 10: 88,091,251 F39I probably benign Het
Psmd7 A T 8: 107,581,288 S188T possibly damaging Het
Pycr2 T A 1: 180,906,348 D168E probably damaging Het
Rab43 A G 6: 87,794,710 Y96H probably damaging Het
Ralgapa2 C T 2: 146,342,414 G1511S probably benign Het
Rb1cc1 T A 1: 6,248,914 C852* probably null Het
Rexo2 T C 9: 48,468,845 N229S probably damaging Het
Sema4f A G 6: 82,913,960 V622A possibly damaging Het
Serpina10 T C 12: 103,628,547 S138G probably benign Het
Sptbn4 T A 7: 27,361,634 T2415S possibly damaging Het
Tbl3 A G 17: 24,702,231 F529L probably damaging Het
Them6 A T 15: 74,721,578 N95I probably benign Het
Thrb T C 14: 18,008,608 S156P possibly damaging Het
Tmem186 G A 16: 8,635,867 R177C probably benign Het
Ttn T A 2: 76,830,593 probably null Het
Unc13a T A 8: 71,658,335 I411F probably benign Het
Uqcc1 T C 2: 155,910,153 probably null Het
Vmn1r56 T C 7: 5,196,517 T34A possibly damaging Het
Vps39 A T 2: 120,325,199 Y542* probably null Het
Wdr64 T C 1: 175,728,976 L263P probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc16 A G 2: 164,635,865 M88T probably benign Het
Wnk4 A G 11: 101,269,577 D679G probably damaging Het
Ykt6 T C 11: 5,962,751 I151T probably benign Het
Zbtb46 A G 2: 181,391,432 C479R probably damaging Het
Zc3h7a A G 16: 11,149,251 I559T probably benign Het
Zfhx3 A G 8: 108,951,651 N3111S possibly damaging Het
Zfp619 T C 7: 39,535,008 V154A possibly damaging Het
Zfp629 A T 7: 127,612,429 D69E probably benign Het
Zfp882 T A 8: 71,914,229 I300N possibly damaging Het
Zfp934 T C 13: 62,518,544 H106R possibly damaging Het
Zfyve9 G A 4: 108,719,101 T261I possibly damaging Het
Other mutations in Tbc1d22b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Tbc1d22b APN 17 29568598 missense possibly damaging 0.60
IGL01836:Tbc1d22b APN 17 29599958 missense probably damaging 1.00
R1524:Tbc1d22b UTSW 17 29570611 missense probably damaging 0.99
R1681:Tbc1d22b UTSW 17 29575177 missense possibly damaging 0.46
R1757:Tbc1d22b UTSW 17 29571673 missense probably damaging 1.00
R2268:Tbc1d22b UTSW 17 29599854 missense probably damaging 1.00
R5656:Tbc1d22b UTSW 17 29594780 missense probably damaging 1.00
R5832:Tbc1d22b UTSW 17 29570647 missense possibly damaging 0.80
R6892:Tbc1d22b UTSW 17 29595890 missense possibly damaging 0.80
R7095:Tbc1d22b UTSW 17 29599869 missense probably damaging 0.96
R8121:Tbc1d22b UTSW 17 29572971 missense probably damaging 1.00
R8784:Tbc1d22b UTSW 17 29599944 missense probably damaging 1.00
R8964:Tbc1d22b UTSW 17 29600228 missense probably damaging 1.00
R9641:Tbc1d22b UTSW 17 29594773 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCAATCCTGTTTCTGTGCC -3'
(R):5'- TACTGGTAGCACCTGTAACCCC -3'

Sequencing Primer
(F):5'- GCCTTGATGGTTTCCAAGC -3'
(R):5'- GGTTTTCAGACTTATAGCACAGCTC -3'
Posted On 2019-11-26