Incidental Mutation 'R7781:Zcchc2'
ID599210
Institutional Source Beutler Lab
Gene Symbol Zcchc2
Ensembl Gene ENSMUSG00000038866
Gene Namezinc finger, CCHC domain containing 2
Synonyms9930114B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105990406-106034074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106004165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 366 (Y366H)
Ref Sequence ENSEMBL: ENSMUSP00000113128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118196] [ENSMUST00000119166]
Predicted Effect probably damaging
Transcript: ENSMUST00000118196
AA Change: Y366H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113974
Gene: ENSMUSG00000038866
AA Change: Y366H

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119166
AA Change: Y366H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113128
Gene: ENSMUSG00000038866
AA Change: Y366H

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Zcchc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc2 APN 1 106030263 missense probably benign 0.25
IGL01339:Zcchc2 APN 1 106029775 missense probably damaging 1.00
IGL01981:Zcchc2 APN 1 106027499 missense probably damaging 1.00
IGL02172:Zcchc2 APN 1 106000934 missense probably benign 0.00
IGL02864:Zcchc2 APN 1 106016084 missense probably damaging 1.00
IGL02993:Zcchc2 APN 1 106030168 missense probably damaging 0.99
IGL03163:Zcchc2 APN 1 106031111 missense probably damaging 1.00
P0042:Zcchc2 UTSW 1 106030997 missense possibly damaging 0.95
R0200:Zcchc2 UTSW 1 106004123 missense probably damaging 1.00
R0477:Zcchc2 UTSW 1 106030270 missense possibly damaging 0.91
R0501:Zcchc2 UTSW 1 106016091 missense possibly damaging 0.88
R0689:Zcchc2 UTSW 1 106030504 nonsense probably null
R1799:Zcchc2 UTSW 1 106030287 missense probably benign 0.00
R2016:Zcchc2 UTSW 1 106004121 splice site probably null
R2153:Zcchc2 UTSW 1 106021723 splice site probably null
R2175:Zcchc2 UTSW 1 106027423 missense probably damaging 1.00
R2999:Zcchc2 UTSW 1 106030024 missense probably benign 0.00
R3113:Zcchc2 UTSW 1 105991022 missense unknown
R4571:Zcchc2 UTSW 1 106031257 missense possibly damaging 0.66
R4670:Zcchc2 UTSW 1 105990266 unclassified probably benign
R5067:Zcchc2 UTSW 1 106030964 missense probably damaging 1.00
R5423:Zcchc2 UTSW 1 106030700 missense probably damaging 1.00
R5499:Zcchc2 UTSW 1 106030592 missense possibly damaging 0.71
R5522:Zcchc2 UTSW 1 106023696 missense probably benign 0.00
R5526:Zcchc2 UTSW 1 106030254 nonsense probably null
R5571:Zcchc2 UTSW 1 106023672 missense probably benign
R5599:Zcchc2 UTSW 1 106032150 missense probably damaging 1.00
R6133:Zcchc2 UTSW 1 106019879 missense probably damaging 1.00
R6191:Zcchc2 UTSW 1 105990170 unclassified probably benign
R6194:Zcchc2 UTSW 1 105991117 missense probably damaging 1.00
R6246:Zcchc2 UTSW 1 106030066 missense possibly damaging 0.75
R7089:Zcchc2 UTSW 1 106030481 missense probably damaging 1.00
R7626:Zcchc2 UTSW 1 106001012 missense possibly damaging 0.69
R7749:Zcchc2 UTSW 1 106018273 missense probably damaging 1.00
R7792:Zcchc2 UTSW 1 106018252 missense probably damaging 0.99
R7982:Zcchc2 UTSW 1 106031171 missense probably damaging 1.00
R8316:Zcchc2 UTSW 1 106032114 missense probably damaging 1.00
R8351:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8451:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8697:Zcchc2 UTSW 1 106030764 missense probably damaging 0.98
R8862:Zcchc2 UTSW 1 106031268 makesense probably null
RF022:Zcchc2 UTSW 1 106011742 missense possibly damaging 0.85
Z1176:Zcchc2 UTSW 1 105991126 missense probably damaging 1.00
Z1177:Zcchc2 UTSW 1 106004136 missense possibly damaging 0.74
Z1177:Zcchc2 UTSW 1 106029825 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACATTCACTTGTGGTTGAGG -3'
(R):5'- ATCGTTTCCCCAAGCTCAGG -3'

Sequencing Primer
(F):5'- TCATGAGTTAAGGCCAGTCATAAAG -3'
(R):5'- ATGGACCATCTATTATCCACCTAC -3'
Posted On2019-11-26