Incidental Mutation 'R7781:Olfr1252'
ID599212
Institutional Source Beutler Lab
Gene Symbol Olfr1252
Ensembl Gene ENSMUSG00000110819
Gene Nameolfactory receptor 1252
SynonymsMOR231-22_p, GA_x6K02T2Q125-51162884-51161940
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89719575-89725012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89721535 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 192 (F192S)
Ref Sequence ENSEMBL: ENSMUSP00000150304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186710] [ENSMUST00000213196] [ENSMUST00000216203]
Predicted Effect probably benign
Transcript: ENSMUST00000186710
AA Change: F192S

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: F192S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213196
AA Change: F192S

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216203
AA Change: F192S

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Olfr1252
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr1252 APN 2 89721526 missense probably damaging 1.00
PIT4151001:Olfr1252 UTSW 2 89721893 missense probably benign 0.42
R1838:Olfr1252 UTSW 2 89721709 missense probably damaging 0.99
R1866:Olfr1252 UTSW 2 89721206 missense probably benign 0.00
R3835:Olfr1252 UTSW 2 89721455 missense possibly damaging 0.75
R4577:Olfr1252 UTSW 2 89722043 missense possibly damaging 0.80
R4675:Olfr1252 UTSW 2 89721494 missense probably benign
R4799:Olfr1252 UTSW 2 89721362 missense probably benign 0.24
R4845:Olfr1252 UTSW 2 89721776 missense probably benign 0.05
R5076:Olfr1252 UTSW 2 89721401 missense probably damaging 1.00
R5160:Olfr1252 UTSW 2 89721419 missense probably damaging 0.99
R5384:Olfr1252 UTSW 2 89721305 missense possibly damaging 0.94
R5418:Olfr1252 UTSW 2 89721999 missense probably benign
R5763:Olfr1252 UTSW 2 89722028 missense probably benign 0.00
R6997:Olfr1252 UTSW 2 89721925 missense possibly damaging 0.71
R7013:Olfr1252 UTSW 2 89721386 missense probably benign 0.20
R7500:Olfr1252 UTSW 2 89721937 missense possibly damaging 0.90
R7608:Olfr1252 UTSW 2 89721298 missense probably benign 0.42
R7671:Olfr1252 UTSW 2 89721259 missense probably damaging 1.00
R7841:Olfr1252 UTSW 2 89721965 missense probably benign 0.06
R7999:Olfr1252 UTSW 2 89722000 missense probably benign 0.06
R8147:Olfr1252 UTSW 2 89721842 missense probably damaging 1.00
R8882:Olfr1252 UTSW 2 89721396 nonsense probably null
X0064:Olfr1252 UTSW 2 89721356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGAGACAGGTCTAACATACATG -3'
(R):5'- CCATCTGTAAGCCACTGCAC -3'

Sequencing Primer
(F):5'- GGTCTAACATACATGAAAATACAGGG -3'
(R):5'- GTAAGCCACTGCACTATTTGAC -3'
Posted On2019-11-26