Incidental Mutation 'R7781:Bnipl'
ID599221
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene NameBCL2/adenovirus E1B 19kD interacting protein like
SynonymsPP753, BNIPL1, 1700128A13Rik, BNIP-S, BNIPL2, BNIPL, BNIPL-2, BNIPL-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95241271-95251193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95244175 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 272 (W272L)
Ref Sequence ENSEMBL: ENSMUSP00000102813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090815] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000107197] [ENSMUST00000125515] [ENSMUST00000137250]
Predicted Effect probably benign
Transcript: ENSMUST00000090815
SMART Domains Protein: ENSMUSP00000088324
Gene: ENSMUSG00000068860

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PMSI1 23 345 3.1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098871
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107195
AA Change: W272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115
AA Change: W272L

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107197
SMART Domains Protein: ENSMUSP00000102815
Gene: ENSMUSG00000068860

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PMSI1 23 130 1.8e-32 PFAM
Pfam:PMSI1 121 184 1.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125515
AA Change: W240L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115
AA Change: W240L

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137250
AA Change: W244L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115
AA Change: W244L

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95242734 missense probably damaging 1.00
IGL02089:Bnipl APN 3 95250266 splice site probably benign
IGL02273:Bnipl APN 3 95245775 missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95244139 splice site probably benign
R0524:Bnipl UTSW 3 95249829 missense probably benign 0.27
R1181:Bnipl UTSW 3 95245649 critical splice donor site probably null
R1926:Bnipl UTSW 3 95243043 missense probably damaging 1.00
R2072:Bnipl UTSW 3 95244211 missense probably damaging 1.00
R2126:Bnipl UTSW 3 95245683 missense probably damaging 1.00
R2196:Bnipl UTSW 3 95249870 missense possibly damaging 0.83
R2898:Bnipl UTSW 3 95243049 missense probably benign 0.44
R7885:Bnipl UTSW 3 95250240 missense probably benign
R7968:Bnipl UTSW 3 95250240 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCTGACCGTAGAGAATACAAC -3'
(R):5'- AAACCCATCGCTGACTGGAG -3'

Sequencing Primer
(F):5'- GTCAGTGATCCCAGCACTTATGAG -3'
(R):5'- GACTGGAGGCTCTCTCTATTCG -3'
Posted On2019-11-26