Mutagenetix > Incidental Mutation

Incidental Mutation 'R7781:Slc4a4'

599226

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7781 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89228932 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1006 (E1006V)

Ref Sequence

ENSEMBL: ENSMUSP00000108844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

AlphaFold

O88343

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113218
AA Change: E1006V

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: E1006V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130041
AA Change: E971V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: E971V

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148750
AA Change: E1015V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: E1015V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: E1015V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: E1015V

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700064H15Rik	G	A	3: 19,628,542	P23S	unknown	Het
Abcc6	C	T	7: 46,005,606	R487Q	probably damaging	Het
Abl1	A	T	2: 31,790,697	T334S	probably damaging	Het
Adam6b	T	C	12: 113,491,342	F593S	probably damaging	Het
Alx1	A	T	10: 103,009,192	M326K	probably damaging	Het
Ankhd1	A	T	18: 36,625,205	D984V	probably damaging	Het
Asb15	A	G	6: 24,562,645	N202S	probably benign	Het
Ate1	A	T	7: 130,519,427	V12E	probably damaging	Het
Atl2	A	T	17: 79,859,831	Y254N	probably damaging	Het
Atp13a5	A	G	16: 29,297,408	M630T	probably benign	Het
Atp5o	A	T	16: 91,926,529	I124N	possibly damaging	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bicdl1	T	C	5: 115,661,487	E181G	probably damaging	Het
Bnipl	C	A	3: 95,244,175	W272L	probably damaging	Het
Catsperd	A	T	17: 56,664,072	H712L	probably benign	Het
Cilp2	T	C	8: 69,882,347	D667G	possibly damaging	Het
Cntn4	A	C	6: 106,523,614	K351Q	probably damaging	Het
Coq7	A	T	7: 118,525,888	I171N	probably damaging	Het
Csf2rb	T	A	15: 78,344,571	F371I	probably benign	Het
Cyp3a13	C	T	5: 137,898,874	V393M	possibly damaging	Het
Dennd2a	A	G	6: 39,493,066	V564A	probably damaging	Het
Ear14	T	C	14: 51,204,011	L108P	probably damaging	Het
Egflam	C	A	15: 7,253,746	V277F	probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Faap100	T	C	11: 120,374,263	M596V	probably benign	Het
Fbxw15	T	A	9: 109,557,262	T270S	possibly damaging	Het
Gabpb1	C	T	2: 126,639,200	C342Y	possibly damaging	Het
Gls	A	T	1: 52,212,333	C288*	probably null	Het
Gm14124	A	T	2: 150,267,657	H89L	possibly damaging	Het
Grm8	G	T	6: 27,285,787	D875E	probably benign	Het
Hdac4	C	A	1: 91,975,665	R514L	probably benign	Het
Hps4	T	A	5: 112,370,522	N460K	probably benign	Het
Inpp5d	T	C	1: 87,699,672	F565S	probably damaging	Het
Kcnh5	C	A	12: 74,976,681	V538F	probably damaging	Het
Kcp	T	C	6: 29,497,765	N499S	probably damaging	Het
Klk15	T	C	7: 43,939,556	L244S	probably benign	Het
Lamp3	A	T	16: 19,699,690	S266T	possibly damaging	Het
Lemd3	A	G	10: 120,925,773	F863L	probably damaging	Het
Mga	T	A	2: 119,917,357	V663D	probably damaging	Het
Naa15	A	G	3: 51,471,483		probably null	Het
Ndrg3	C	A	2: 156,928,813	G352*	probably null	Het
Nr2f6	G	T	8: 71,375,951	N233K	possibly damaging	Het
Olfr1252	A	G	2: 89,721,535	F192S	probably benign	Het
Plxnb2	T	A	15: 89,157,022	M1774L	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rpl23a	G	A	11: 78,182,828	R62W	probably benign	Het
Rubcnl	A	G	14: 75,032,090	R63G	probably damaging	Het
Ryr1	T	C	7: 29,067,630	D2976G	probably damaging	Het
Siglec1	A	G	2: 131,081,338	Y496H	probably damaging	Het
Sipa1l2	A	G	8: 125,491,827	V257A	possibly damaging	Het
Slc24a4	T	C	12: 102,234,853		probably null	Het
Slc4a1ap	T	C	5: 31,527,478	S153P	probably damaging	Het
Svep1	T	G	4: 58,069,251	E2845A	possibly damaging	Het
Tlr1	T	C	5: 64,926,736	N166S	possibly damaging	Het
Tmem231	C	T	8: 111,918,290		probably null	Het
Tsc2	C	A	17: 24,608,115	L873F	possibly damaging	Het
Unc13b	T	G	4: 43,259,546	S1403A	possibly damaging	Het
Vmn1r7	A	G	6: 57,024,568	F236L	probably benign	Het
Vmn2r111	T	C	17: 22,570,733	S431G	probably benign	Het
Wdr7	A	T	18: 63,777,789	K751*	probably null	Het
Wdr90	C	T	17: 25,846,326	R1652Q	probably damaging	Het
Zcchc2	T	C	1: 106,004,165	Y366H	probably damaging	Het
Zfp607a	C	T	7: 27,865,575	R56C	possibly damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
Therapod	UTSW	5	89135722	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
R8735:Slc4a4	UTSW	5	89132442	missense	probably damaging	1.00
R8786:Slc4a4	UTSW	5	89084690	missense	probably benign	0.07
R8968:Slc4a4	UTSW	5	89084653	missense	probably benign
R9014:Slc4a4	UTSW	5	89132386	missense	probably damaging	1.00
R9031:Slc4a4	UTSW	5	89057709	intron	probably benign
R9195:Slc4a4	UTSW	5	89133196	missense	possibly damaging	0.82
R9236:Slc4a4	UTSW	5	89046299	nonsense	probably null
R9261:Slc4a4	UTSW	5	89199709	missense	probably damaging	1.00
R9325:Slc4a4	UTSW	5	89228897	missense	probably damaging	1.00
R9401:Slc4a4	UTSW	5	89179666	missense	probably damaging	1.00
R9457:Slc4a4	UTSW	5	89214573	missense	probably damaging	1.00
R9462:Slc4a4	UTSW	5	89046272	missense	probably damaging	1.00
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGTAAGGATTTCTGCTGGG -3'
(R):5'- TTGGTCAGATGATCCTCTGGAGC -3'

Sequencing Primer
(F):5'- AAGGATTTCTGCTGGGGTTCTAGC -3'
(R):5'- AGATGATCCTCTGGAGCCTTCAG -3'

Posted On

2019-11-26