Incidental Mutation 'R7781:Bicdl1'
ID599228
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene NameBICD family like cargo adaptor 1
Synonyms2210403N09Rik, Ccdc64, BICDR-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115648175-115731621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115661487 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 181 (E181G)
Ref Sequence ENSEMBL: ENSMUSP00000119664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000148276]
Predicted Effect probably benign
Transcript: ENSMUST00000055408
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148276
AA Change: E181G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119664
Gene: ENSMUSG00000041609
AA Change: E181G

DomainStartEndE-ValueType
coiled coil region 1 110 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
coiled coil region 178 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115731292 missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115651857 missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTAGGTAAAGGCCCCGTG -3'
(R):5'- TAAGGAAGATGCCAGTGCTTTTG -3'

Sequencing Primer
(F):5'- GCACACTCTCTGCACTGTGAAAC -3'
(R):5'- GTTTGTAGCGCGCGCAG -3'
Posted On2019-11-26