Incidental Mutation 'R7781:Abcc6'
ID 599240
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 045837-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R7781 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45655030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 487 (R487Q)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: R487Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: R487Q

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,682,706 (GRCm39) P23S unknown Het
Abl1 A T 2: 31,680,709 (GRCm39) T334S probably damaging Het
Adam6b T C 12: 113,454,962 (GRCm39) F593S probably damaging Het
Alx1 A T 10: 102,845,053 (GRCm39) M326K probably damaging Het
Ankhd1 A T 18: 36,758,258 (GRCm39) D984V probably damaging Het
Asb15 A G 6: 24,562,644 (GRCm39) N202S probably benign Het
Ate1 A T 7: 130,121,157 (GRCm39) V12E probably damaging Het
Atl2 A T 17: 80,167,260 (GRCm39) Y254N probably damaging Het
Atp13a5 A G 16: 29,116,226 (GRCm39) M630T probably benign Het
Atp5po A T 16: 91,723,417 (GRCm39) I124N possibly damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bicdl1 T C 5: 115,799,546 (GRCm39) E181G probably damaging Het
Bnipl C A 3: 95,151,486 (GRCm39) W272L probably damaging Het
Catsperd A T 17: 56,971,072 (GRCm39) H712L probably benign Het
Cilp2 T C 8: 70,334,997 (GRCm39) D667G possibly damaging Het
Cntn4 A C 6: 106,500,575 (GRCm39) K351Q probably damaging Het
Coq7 A T 7: 118,125,111 (GRCm39) I171N probably damaging Het
Csf2rb T A 15: 78,228,771 (GRCm39) F371I probably benign Het
Cyp3a13 C T 5: 137,897,136 (GRCm39) V393M possibly damaging Het
Dennd2a A G 6: 39,470,000 (GRCm39) V564A probably damaging Het
Ear14 T C 14: 51,441,468 (GRCm39) L108P probably damaging Het
Egflam C A 15: 7,283,227 (GRCm39) V277F probably null Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Faap100 T C 11: 120,265,089 (GRCm39) M596V probably benign Het
Fbxw15 T A 9: 109,386,330 (GRCm39) T270S possibly damaging Het
Gabpb1 C T 2: 126,481,120 (GRCm39) C342Y possibly damaging Het
Gls A T 1: 52,251,492 (GRCm39) C288* probably null Het
Grm8 G T 6: 27,285,786 (GRCm39) D875E probably benign Het
Hdac4 C A 1: 91,903,387 (GRCm39) R514L probably benign Het
Hps4 T A 5: 112,518,388 (GRCm39) N460K probably benign Het
Inpp5d T C 1: 87,627,394 (GRCm39) F565S probably damaging Het
Kcnh5 C A 12: 75,023,455 (GRCm39) V538F probably damaging Het
Kcp T C 6: 29,497,764 (GRCm39) N499S probably damaging Het
Klk15 T C 7: 43,588,980 (GRCm39) L244S probably benign Het
Lamp3 A T 16: 19,518,440 (GRCm39) S266T possibly damaging Het
Lemd3 A G 10: 120,761,678 (GRCm39) F863L probably damaging Het
Mga T A 2: 119,747,838 (GRCm39) V663D probably damaging Het
Naa15 A G 3: 51,378,904 (GRCm39) probably null Het
Ndrg3 C A 2: 156,770,733 (GRCm39) G352* probably null Het
Nr2f6 G T 8: 71,828,595 (GRCm39) N233K possibly damaging Het
Or4a79 A G 2: 89,551,879 (GRCm39) F192S probably benign Het
Plxnb2 T A 15: 89,041,225 (GRCm39) M1774L possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rpl23a G A 11: 78,073,654 (GRCm39) R62W probably benign Het
Rubcnl A G 14: 75,269,530 (GRCm39) R63G probably damaging Het
Ryr1 T C 7: 28,767,055 (GRCm39) D2976G probably damaging Het
Siglec1 A G 2: 130,923,258 (GRCm39) Y496H probably damaging Het
Sipa1l2 A G 8: 126,218,566 (GRCm39) V257A possibly damaging Het
Slc24a4 T C 12: 102,201,112 (GRCm39) probably null Het
Slc4a1ap T C 5: 31,684,822 (GRCm39) S153P probably damaging Het
Slc4a4 A T 5: 89,376,791 (GRCm39) E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 (GRCm39) E2845A possibly damaging Het
Tlr1 T C 5: 65,084,079 (GRCm39) N166S possibly damaging Het
Tmem231 C T 8: 112,644,922 (GRCm39) probably null Het
Tsc2 C A 17: 24,827,089 (GRCm39) L873F possibly damaging Het
Unc13b T G 4: 43,259,546 (GRCm39) S1403A possibly damaging Het
Vmn1r7 A G 6: 57,001,553 (GRCm39) F236L probably benign Het
Vmn2r111 T C 17: 22,789,714 (GRCm39) S431G probably benign Het
Wdr7 A T 18: 63,910,860 (GRCm39) K751* probably null Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Zcchc2 T C 1: 105,931,895 (GRCm39) Y366H probably damaging Het
Zfp1005 A T 2: 150,109,577 (GRCm39) H89L possibly damaging Het
Zfp607a C T 7: 27,565,000 (GRCm39) R56C possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAATGACGTCACCAGAAATG -3'
(R):5'- ATTGGTGCAGTGACAGCAGG -3'

Sequencing Primer
(F):5'- CGTCACCAGAAATGTAGACACTTGG -3'
(R):5'- TAGTGTAGCTCAGGACCCTGTC -3'
Posted On 2019-11-26